|
|
||||||||
Cardiovascular-Pulmonary Research Laboratory, Departments of 1 Medicine and 2 Physiology and Biophysics, University of Colorado Health Sciences Center, Denver, Colorado 80262
| |
ABSTRACT |
|---|
|
|
|---|
During hepatopulmonary syndrome caused by liver cirrhosis, pulmonary endothelial nitric oxide (NO) synthase (NOS) expression and NO production are increased. Increased NO contributes to the blunted hypoxic pressor response (HPR) during cirrhosis and may induce heme oxygenase-1 (HO-1) expression and carbon monoxide (CO) production, exacerbating the blunted HPR. We hypothesized that NO regulates the expression of HO-1 during cirrhosis, contributing to hepatopulmonary syndrome. Cirrhosis was induced in rats by common bile duct ligation (CBDL). Rats were studied 2 and 5 wk after CBDL or sham surgery. Lung HO-1 expression was elevated 5 wk after CBDL. Liver HO-1 was increased at 2 wk and remained elevated at 5 wk. In catheterized rats, the blunted HPR was partially restored by HO inhibition. Rats treated with the NOS inhibitor NG-nitro-L-arginine methyl ester for the entire 2- or 5-wk duration had normalized HO-1 expression and HPR. These data provide in vivo evidence for the NO-mediated upregulation of HO-1 expression and support the concept that hepatopulmonary syndrome is multifactorial, involving not only NO, but also HO-1 and CO.
carbon monoxide; cirrhosis; endothelial nitric oxide synthase; pulmonary vasoreactivity; calcium-activated potassium channels
| |
INTRODUCTION |
|---|
|
|
|---|
ENDOTHELIUM-DERIVED NITRIC OXIDE (NO) produced by the enzymatic activity of endothelial nitric oxide synthase (eNOS) has well-characterized actions as a vasodilator (33). Once produced, NO is freely diffusible and enters vascular smooth muscle cells (VSMCs) to activate soluble guanylate cyclase and produce guanosine 3',5'-cyclic monophosphate (cGMP) (26, 33). In pulmonary artery (PA) VSMCs, increased cGMP activates a cGMP- sensitive kinase, which phosphorylates a calcium-dependent potassium (KCa) channel leading to hyperpolarization and vasodilation (7, 26, 33). Although most of the NO production in the vascular endothelium is due to eNOS, some studies suggest that the two other isoforms of NOS, inducible NOS and neuronal NOS, may also be present in the vasculature and contribute to NO production (20, 29, 30).
Heme oxygenase-1 (HO-1) catalyzes the rate-limiting step in the oxidative degradation of heme to biliverdin, releasing equimolar amounts of carbon monoxide (CO) and iron (5). Biliverdin is subsequently reduced to bilirubin by biliverdin reductase (5). CO, a gaseous messenger similar to NO, shares many properties with NO, including activation of guanylate cyclase, signal transduction, and gene regulation and may mediate important cellular functions (34).
In addition to its action as a vasodilator, NO can regulate the expression of a variety of genes. In particular, there is solid evidence that NO regulates the expression of HO-1 (1, 4, 15). For example, treating aortic smooth muscle cells with the NO donor spermine NONOate (SNN) increases HO-1 gene transcription, resulting in increased mRNA and protein expression (15). This induction of HO-1 by NO occurs in a cGMP-independent manner. The pathways by which NO regulates the expression of HO-1 and other genes are complex and not completely worked out but appear to involve mitogen-activated protein kinase (MAPK) members such as extracellular signal-regulated kinase (ERK) and p38 (4).
Often during liver cirrhosis there are pulmonary vascular complications leading to systemic hypoxemia (9, 10). This condition is termed the hepatopulmonary syndrome. A prominent feature of hepatopulmonary syndrome is a blunted hypoxic pressor response (HPR), that is, the pulmonary circulation has a reduced ability to vasoconstrict in the presence of hypoxic stimuli. Recent evidence has implicated NO in the pathogenesis of hepatopulmonary syndrome. Clinically, levels of exhaled NO are increased in cirrhotic patients (32). We (3) and others (11) have demonstrated that pulmonary expression of eNOS is increased during experimental cirrhosis induced in rats by common bile duct ligation (CBDL). However, we also have demonstrated that the vasodilatory action of NO alone does not completely account for the blunted HPR (3). We found that the acute inhibition of NOS and guanylate cyclase did not restore normal hypoxic vasoreactivity in cirrhotic rat lungs and that activation of PA smooth muscle cell KCa channels by both NO-dependent and -independent mechanisms caused hyperpolarization and vasodilation (3). In view of the evidence that NO can induce HO-1 expression (15) and that HO-1-derived CO can activate KCa channels (35-37), we investigated the expression of HO-1 in two tissues central to the development of hepatopulmonary syndrome: lung and liver. There were two main objectives of this study: First, to determine whether HO-1 expression in the lung and liver is regulated in a tissue-specific fashion during CBDL-induced liver cirrhosis and whether there are functional consequences associated with such changes; second, to determine whether chronic inhibition of NO reverses the CBDL-induced changes in HO-1 expression and restores normal hypoxic pulmonary vasoreactivity. We hypothesized that HO-1 expression in liver would be upregulated early, closely followed by increased expression in lung. We further hypothesized that upregulation of HO-1 could be blocked by chronic inhibition of NOS. Our major findings were that after CBDL, hepatic HO-1 was potently upregulated, closely followed by pulmonary HO-1. Inhibition of HO-1 activity partially restored the blunted HPR in CBDL rats, functionally implicating HO-1 in the blunted HPR. Finally, both the HO-1 induction and blunted HPR were abolished by chronic NG-nitro-L-arginine methyl ester (L-NAME) treatment.
| |
METHODS |
|---|
|
|
|---|
Animal model of liver cirrhosis. Biliary cirrhosis was induced in rats by CBDL (3, 12, 22). The surgical procedures were approved by the Animal Care and Use Committee at the University of Colorado Health Sciences Center. Male Sprague-Dawley rats [200-250 g body wt (bw)] were allowed to acclimate to Denver's altitude (1,500 m) for 1 wk before any experimental protocols. Animals had continuous access to food and water. Laparotomy was performed under anesthesia of ketamine (100 mg/kg im) and xylazine (4 mg/kg im). The bile duct was isolated, doubly ligated with 3-0 silk, and resected between the two ligatures. The abdominal wall was closed with 4-0 silk, antibiotic sulfa powder sprinkled over the closure, and the skin was closed with 4-0 silk. Buprenorphine (0.25 mg/kg) was given subcutaneously twice during the first 24 h after surgery to alleviate postsurgical discomfort. Sham animals underwent laparotomy, bile duct isolation with no ligation and resection, and closure of the surgical opening. Experiments were carried out 2 and 5 wk after surgery. We evaluated liver injury by measuring serum levels of bilirubin using a bilirubin direct assay (Sigma, St. Louis, MO).
Chronic inhibition of NOS.
One day after surgery, specified groups of sham and CBDL rats received
the nonselective NOS inhibitor L-NAME in their drinking water (6 mg/l, ~0.072 mg · day
1 · 100 g
bw
1). This dose in rats normalizes the systemic vascular
changes that occur during cirrhosis (24) and pregnancy
(2) without causing systemic hypertension. Rats received
the L-NAME treatment for the duration of the 2- or 5-wk experiment.
HO activity inhibition. To investigate the role of HO and HO-derived CO in the blunted HPR, we treated specified groups of sham and CBDL rats with the specific HO inhibitor zinc protoporphyrin (ZnPP, 50 µmol/kg ip). Rats were treated once, 18 h before we measured hemodynamics described in the next section. During and after ZnPP treatment, rats were kept in low-light conditions because of the high photoinactivation of porphyrin compounds.
Arterial blood gas and hemodynamic measurements. At 2 and 5 wk postsurgery, rats were anesthetized with ketamine and xylazine, as described in Animal model of liver cirrhosis. Catheters (PE-50 tubing) were placed in the carotid artery and PA via the right jugular vein and right ventricle. The catheters were passed subcutaneously and exteriorized at the scapulae. Rats were allowed to recover for 24 h before arterial blood gases, mean arterial pressure (MAP), and pulmonary artery pressure (PAP) were measured in conscious rats breathing room air, 10% O2, and 100% O2. The change in PAP from room air to 10% O2 is defined as the HPR. In addition, blood carboxyhemoglobin (COHb) was used as an index for the amount of CO in the blood. Arterial blood (30-50 µl) was collected in a heparinized syringe at the beginning of studies. Samples were measured by an OMS3 Hemoxyradiometer (Radiometer, Copenhagen, Denmark).
Northern blot analysis of lung and liver HO-1 mRNA expression.
Rats were anesthetized with ketamine and xylazine, and the PA and left
ventricle were perfused with PBS containing heparin to flush free of
blood the lungs and systemic organs, respectively. The left lung and
one liver lobe were excised and immediately placed in 8 ml of
homogenizing solution (4 M guanidine, 0.1 M Tris, pH 7.5, 0.1 M
2-mercaptoethanol) and homogenized for 45 s with a torque grinder.
After homogenization, 50 µl of 10% sarkosyl/ml homogenate (final
concentration = 0.5% sarkosyl) were added, and the tubes were
frozen in liquid nitrogen. The right lung and a second liver lobe were
removed and processed for protein extraction, as described below. Total
RNA was extracted from peripheral lung and liver by a standard
guanidinium-phenol-chloroform extraction protocol. We determined the
quantity of RNA by measuring the optical density at 260 nm
(OD260 = 1 for 40 µg/ml RNA), and we assessed the
purity by determining the ratio of the optical density obtained 260 and
280 nm (pure RNA: OD260/OD280 = 2.0) using a Beckman DU-640 spectrophotometer. Total RNA (20 µg) was
electrophoresed through a formaldehyde-agarose gel and blotted to a
nylon membrane using capillary transfer. RNA was immobilized on the
nylon membrane by ultraviolet cross-linking. HO-1 mRNA was detected
with a 2.0-kb cDNA probe labeled with [
-32P]dCTP using
random-primed labeling (RTS Random Primer DNA Labeling System;
GIBCO-BRL, Gaithersburg, MD). 18S rRNA levels were measured by
hybridization with an oligonucleotide probe (ACGGTATCTGATCCGTCTTCGAACC) labeled with [
-32P]dCTP using terminal
deoxytransferase. After hybridization, blots were washed at room
temperature in 0.15 M NaCl and 0.015 M sodium citrate, pH 7.0 (1×
SSC)-0.1% SDS (low stringency) and then at 65°C in 0.4× SSC-0.1%
SDS (high stringency). We obtained autoradiographs by exposing blots to
phosphorimaging cassettes, and densitometry was performed on a
phosphorimaging system with ImageQuant software (Molecular Dynamics,
Sunnyvale, CA).
Western blot analysis of HO-1 expression.
As with the Northern blot analysis, standard techniques were used to
evaluate protein expression. The right lung and one liver lobe, from
the above blood-free perfusion, were homogenized in 250 mM sucrose, 25 mM imidazole, 1 mM EDTA, and 1/10 volume of a protease solution
consisting of 25 µg/ml antipain, 1 µg/ml aprotinin, 0.5 µg/ml
leupeptin, 0.7 µg/ml pepstatin, 0.1 mg/ml soybean trypsin inhibitor,
and 200 µM phenylmethylsulfonyl fluoride. After homogenization, samples were sonicated and spun at low speed to clear debris, and the
supernatant was frozen at
80°C until assayed for protein content.
SDS-PAGE/immunoblotting was performed on 25 µg of protein. Samples
were electrophoresed through a 12% acrylamide gel for detection of
HO-1 (molecular mass = 30 kDa). HO-1 protein was detected using a
polyclonal antibody (StressGen Biotechnologies, Victoria, British
Columbia, Canada) diluted 1:1,000 in Tris-buffered saline + 0.1%
Tween 20 (TBS-T) containing 5% dry milk. The secondary antibody (sheep anti-rabbit conjugated to horseradish peroxidase) was
diluted 1:17,000 in TBS-T containing 5% dry milk. Antigenic detection
was by enhanced chemiluminescence (Amersham, Arlington Heights, IL)
with exposure to X-ray film. Densitometry was performed with a scanner
and NIH Image software (version 1.61).
Statistical analysis.
All values reported are means ± SE. We carried out comparisons
between groups using the analysis of variance followed by Tukey's post
hoc analysis. Values of P < 0.05 were considered
significant. Sample sizes of specific groups are listed in the figure
legends (Figs. 1-6).
|
|
|
|
|
|
| |
RESULTS |
|---|
|
|
|---|
Characterization of cirrhosis induction by CBDL.
The physiological and biochemical changes associated with CBDL have
been previously reported (3, 12, 22). As is typical after
CBDL, serum levels of bilirubin were elevated by 2 wk after CBDL,
indicative of liver injury (Table 1).
CBDL rats were slightly hypoxemic by 2 wk and more profoundly so by 5 wk (Table 1). However, when the rats breathed 100% O2, the
differences in arterial O2 tension between the sham and
CBDL rats were no longer present. MAP was slightly lower in the 2-wk
CBDL rats and significantly lower in the 5-wk CBDL rats compared with
time-matched sham rats (Table 1).
|
HO-1 expression is increased after CBDL. We and others have previously found that after CBDL, lung eNOS protein expression is increased (3, 11) and preproendothelin-1 mRNA is decreased (3). We compared the pattern of expression of HO-1 in the lung and liver to determine whether the expression resembles that seen with eNOS. In the lung, HO-1 mRNA was not significantly changed 2 wk after CBDL but increased >14-fold by 5 wk (Fig. 1A). HO-1 protein expression in lung followed a similar pattern of expression as with the mRNA, with a slight increase at 2 wk and a greater than fivefold increase by 5 wk (Fig. 1B). In the liver, HO-1 mRNA induction was more rapid and sustained, with a significant 14-fold induction at 2 wk and nearly fivefold 5 wk after CBDL compared with time-matched controls (Fig. 2A). Similarly, hepatic HO-1 protein expression in CBDL rats was elevated nearly fivefold at 2 wk and threefold by 5 wk (Fig. 2B).
Circulating CO is increased after CBDL. A byproduct of HO-1 activity is CO. HO-1 activity is the primary source of circulating CO (17). In the circulation, CO is found predominately bound to hemoglobin in the form of COHb. To determine whether elevated levels of circulating CO accompanied the strong induction of HO-1 in the lung and liver, we measured the amount of COHb in the blood of sham and CBDL rats. Figure 3 illustrates that levels of COHb were significantly elevated at both the 2-wk and 5-wk time points in the blood from CBDL rats compared with sham rats.
HO activity contributes to blunted HPR. To evaluate the functional consequences of the HO-1 induction, we treated sham and CBDL rats with the specific HO inhibitor ZnPP. Studies were carried out at the 5-wk time point when HO-1 induction and HPR blunting were maximal. HO inhibition resulted in partial restoration of the blunted HPR in the CBDL rats (Figure 4). ZnPP treatment altered neither the HPR in sham rats (Fig. 4) nor the systemic pressure in sham and CBDL rats (not shown).
NOS inhibition blocks HO-1 induction and lowers COHb levels in CBDL rats. Elevated NO has been implicated in the pulmonary and systemic circulatory abnormalities during cirrhosis. To determine what effect NOS inhibition has on cardiovascular dynamics and HO-1 expression during cirrhosis, we treated sham and CBDL rats with L-NAME for either 2 or 5 wk. The dose of L-NAME used did not cause systemic hypertension in sham rats and reversed the systemic hypotension in the CBDL rats (Table 1). L-NAME treatment abolished the hypoxemia in CBDL rats during room air breathing. This was associated with restoration of the HPR, which was not different between the sham and CBDL rats treated with L-NAME (Fig. 5).
To determine whether elevated NO that occurs after CBDL was responsible for the induction of pulmonary and hepatic HO-1, we examined HO-1 expression in rats treated with L-NAME for 2 and 5 wk after CBDL. In the lung, the increased HO-1 protein expression after CBDL was prevented and reduced, respectively, at the 2- and 5-wk time points, respectively (Fig. 6A). Of the eight CBDL lungs studied at the 5-wk time point, L-NAME treatment completely reversed the HO-1 induction in four and partially inhibited the L-NAME induction in the other four. In the liver, the strong induction by CBDL was prevented by L-NAME treatment in all of the rats studied (Fig. 6A). Densitometric analysis of lung and liver HO-1 protein expression from the entire set of L-NAME-treated rats is shown (Fig. 6B). Consistent with the reduced HO-1 expression in CBDL rats after L-NAME treatment, the level of circulating COHb was also significantly reduced (Fig. 3).| |
DISCUSSION |
|---|
|
|
|---|
We have recently reported that eNOS expression in lung and plasma NO metabolites (NOx) levels are elevated after CBDL but that the acute inhibition of NO only partially reversed the blunted hypoxic pulmonary vasoconstriction (3). We therefore considered the possibility that the elevated NO during cirrhosis was acting not only as a vasodilator, but also as a regulator of gene expression of other vasoactive mediators such as HO-1 (8, 14). CO, an HO-1 byproduct, activates guanylate cyclase, leading to accumulation of cGMP and VSMC relaxation (6, 13, 16, 18, 23, 31). CO can also cause vasodilation by cGMP-independent pathways, possibly by directly activating KCa channels (19, 35-37) and/or inhibiting production of endothelin (25). Thus we postulated that pulmonary HO-1 is induced by NO and that HO-1-derived CO could be contributing to the NO-independent, KCa channel-dependent vasodilation we have recently reported (3). Therefore, there were two main objectives of this study: First, to determine whether HO-1 expression in lung and liver is regulated in a tissue-specific fashion during CBDL-induced liver cirrhosis and whether there are functional consequences associated with such changes; second, to determine whether chronic inhibition of NO reverses the CBDL-induced changes in HO-1 expression and restores normal hypoxic pulmonary vasoreactivity.
We observed that after CBDL, HO-1 expression in the lung closely followed the pattern of expression of eNOS previously observed (3, 11). Regulation of HO-1 expression by NO has been demonstrated in a variety of cell types, primarily in cell culture experiments (1, 8, 15). VSMCs treated with the NO donor SNN for 4 h had a 105-fold induction of HO-1 mRNA (15). Treatment of rat aortic VSMCs with the NO donors sodium nitroprusside (SNP), S-nitroso-N-acetyl-penicillamine, or 3-morpholinosydnonimine increases HO-1 mRNA and protein expression in a concentration- and time-dependent manner (8). In HeLa cells treated with SNP, the NO-dependent HO-1 induction took place via MAPK ERK (4). During cirrhosis, it has been widely reported that circulating levels of NOX (3), pulmonary expression of eNOS (3, 11, 27), and exhaled amounts of NO (32) are all elevated. Our data, together with these earlier reports, support our hypothesis that NO regulates HO-1 expression in our in vivo model similarly to what has been reported in in vitro models.
HO-1 induction in VSMCs is associated with increased production and release of CO (8). In the present study, circulating levels of CO, in the form of COHb, were significantly elevated in CBDL rats consistent with the fact that both HO-1 expression and activity were increased. The functional evidence of these changes was apparent in our observation that HO inhibition partially restored the blunted HPR in the CBDL rats. The increased HO-1 activity may be an important component of the acute NO-independent, KCa channel-dependent pulmonary vasodilation during CBDL that we recently reported (3). In VSMCs, exogenous CO activates a 238-pS KCa channel independently of cGMP and without altering intracellular [Ca2+] (37) and a 105-pS KCa channel, also independently of cGMP (17). Finally, the HO-CO pathway has been recently implicated in the cardiomyopathy of cirrhosis in CBDL rats (21). HO-1 expression and activity in the heart were increased in CBDL rats (21). Inhibiting HO activity with ZnPP restored the blunted papillary muscle contractility while having no effect on control muscles (21). Thus it is plausible that NO and HO-1-derived CO are central to the pulmonary and cardiovascular pathophysiology of cirrhosis and hepatopulmonary syndrome.
We hypothesized that NO regulates the expression of HO-1 during cirrhosis. This hypothesis was tested through the chronic inhibition of NOS activity by L-NAME added to the rats' drinking water for 2 or 5 wk. A common occurrence of NOS inhibition by L-NAME and similar compounds is the development of systemic hypertension. We selected a dose of L-NAME that has previously been shown to inhibit NOS activity without causing systemic hypertension (2, 24). In our experiments, MAP was not different between the L-NAME- treated and untreated rats (Table 1). In CBDL rats treated with L-NAME, the induction of HO-1 was markedly reduced in both the lung and liver. Although these results support our hypothesis of NO being a regulator of gene expression during cirrhosis, we acknowledge that HO-1 gene expression is certainly more complex than NO's simply acting as an enhancer of HO-1 transcription. We, therefore, have to consider that additional factors may be regulating HO-1 expression. These may include flow and shear stress phenomena and growth factors and cytokines.
In addition to the normalization of HO-1 expression, chronic L-NAME treatment also preserved hypoxic pulmonary vasoconstriction in CBDL rats. This is an important physiological observation linking both NO and HO-1 to the blunted HPR during hepatopulmonary syndrome. Although the beneficial effects of NO inhibition on renal function during cirrhosis have been reported (24), our data along with those recently reported by Nunes et al. (28) are the first to demonstrate that chronic inhibition of NO production may ameliorate hepatopulmonary syndrome.
Although HO-1 expression was elevated in both the lung and liver of CBDL rats, the time course and magnitude of induction were different between the two organs. In the liver, HO-1 mRNA induction was rapid, sustained, and of a greater magnitude than that in the lung. The rapid onset of HO-1 induction at the 2-wk time point may be due to the fact that the injury originates in the liver and HO-1 induction is a stress response to the local hepatic injury during CBDL. The greater magnitude of HO-1 mRNA induction compared with that in the lung might be due to the fact that HO-1 is responding to both elevated NO and the continual stress response created by CBDL injury. Because the HO-1 mRNA induction in lung was slower (not until wk 5) and of a lesser magnitude (2-fold vs. 14-fold) than in liver, it is possible that local stress-response factors from the liver are not governing HO-1 expression in the lung. Rather, elevated lung NO may be the primary mechanism by which lung HO-1 expression is increased during cirrhosis. A larger elusive question still remains of what factor(s) is behind the induction of eNOS and NO during cirrhosis both systemically and in the lung. Candidates that have been considered include shear stress associated with the hyperdynamic circulation and hepatically derived cytokines and growth factors. Further studies are needed to address these questions.
In summary, we have demonstrated a combined role for NO and HO-1 in the development of hepatopulmonary syndrome during cirrhosis. Our data support the hypothesis that NO has a dual role in the development of the blunted HPR during cirrhosis 1) as a vasodilator contributing to the blunted HPR and 2) as a regulator of expression of other vasoactive genes, such as HO-1.
| |
ACKNOWLEDGEMENTS |
|---|
This work was supported by an American Heart Association Scientist Development Award (to E. P. Carter) and National Institutes of Health Grants DK-02884 and HL-64919 (to E. P. Carter) and HL-14985 (to I. F. McMurtry). E. P. Carter also received financial support from the Department of Medicine at the University of Colorado Health Sciences Center.
| |
FOOTNOTES |
|---|
Address for reprint requests and other correspondence: E. P. Carter, Campus Box B-133, 4200 E. 9th Ave., Denver, CO 80262 (E-mail: Ethan.Carter{at}uchsc.edu).
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
March 29, 2002;10.1152/ajplung.00385.2001
Received 28 September 2001; accepted in final form 26 March 2002.
| |
REFERENCES |
|---|
|
|
|---|
1.
Alcaraz, MJ,
Habib A,
Creminon C,
Vicente AM,
Lebret M,
Levy-Toledano S,
and
Maclouf J.
Heme oxygenase-1 induction by nitric oxide in RAW 264.7 macrophages is upregulated by a cyclo-oxygenase-2 inhibitor(1).
Biochim Biophys Acta
1526:
13-16,
2001[Medline].
2.
Cadnapaphornchai, MA,
Ohara M,
Morris KG, Jr,
Knotek M,
Rogachev B,
Ladtkow T,
Carter EP,
and
Schrier RW.
Chronic NOS inhibition reverses systemic vasodilation and glomerular hyperfiltration in pregnancy.
Am J Physiol Renal Physiol
280:
F592-F598,
2001
3.
Carter, EP,
Sato K,
Morio Y,
and
McMurtry IF.
Inhibition of KCa channels restores blunted hypoxic pulmonary vasoconstriction in rats with cirrhosis.
Am J Physiol Lung Cell Mol Physiol
279:
L903-L910,
2000
4.
Chen, K,
and
Maines MD.
Nitric oxide induces heme oxygenase-1 via mitogen-activated protein kinases ERK and p38.
Cell Mol Biol (Noisy-le-grand)
46:
609-617,
2000.
5.
Choi, AMK,
and
Alam J.
Heme oxygenase-1: function, regulation, and implication of a novel stress-inducible protein in oxidant-induced lung injury.
Am J Respir Cell Mol Biol
15:
9-19,
1996[Abstract].
6.
Christodoulides, N,
Durante W,
Kroll MH,
and
Schafer AI.
Vascular smooth muscle cell heme oxygenases generate guanylyl cyclase-stimulatory carbon monoxide.
Circulation
91:
2306-9,
1995
7.
Cornfield, DN,
Reeve HL,
Tolarova S,
Weir EK,
and
Archer S.
Oxygen causes fetal pulmonary vasodilation through activation of a calcium-dependent potassium channel.
Proc Natl Acad Sci USA
93:
8089-8094,
1996
8.
Durante, W,
Kroll MH,
Christodoulides N,
Peyton KJ,
and
Schafer AI.
Nitric oxide induces heme oxygenase-1 gene expression and carbon monoxide production in vascular smooth muscle cells.
Circ Res
80:
557-564,
1997
9.
Fallon, MB,
and
Abrams GA.
Hepatopulmonary syndrome.
Curr Gastroenterol Rep
2:
40-45,
2000[Medline].
10.
Fallon, MB,
and
Abrams GA.
Pulmonary dysfunction in chronic liver disease.
Hepatology
32:
859-865,
2000[ISI][Medline].
11.
Fallon, MB,
Abrams GA,
Luo B,
Hou Z,
Dai J,
and
Ku DD.
The role of endothelial nitric oxide synthase in the pathogenesis of a rat model of hepatopulmonary syndrome.
Gastroenterology
113:
606-614,
1997[ISI][Medline].
12.
Fallon, MB,
Abrams GA,
McGrath HZ,
and
Luo B.
Common bile duct ligation in the rat: a model of intrapulmonary vasodilatation and hepatopulmonary syndrome.
Am J Physiol Gastrointest Liver Physiol
272:
G779-G784,
1997
13.
Furchgott, RF,
and
Jothianandan D.
Endothelium-dependent and -independent vasodilation involving cyclic GMP: relaxation induced by nitric oxide, carbon monoxide and light.
Blood Vessels
28:
52-61,
1991[ISI][Medline].
14.
Hartsfield, CL,
Alam J,
and
Choi AM.
Transcriptional regulation of the heme oxygenase 1 gene by pyrrolidine dithiocarbamate.
FASEB J
12:
1675-1682,
1998
15.
Hartsfield, CL,
Alam J,
Cook JL,
and
Choi AM.
Regulation of heme oxygenase-1 gene expression in vascular smooth muscle cells by nitric oxide.
Am J Physiol Lung Cell Mol Physiol
273:
L980-L988,
1997
16.
Hussain, AS,
Marks GS,
Brien JF,
and
Nakatsu K.
The soluble guanylyl cyclase inhibitor 1H-[1,2,4]oxadiazolo[4,3-alpha]quinoxalin-1-one (ODQ) inhibits relaxation of rabbit aortic rings induced by carbon monoxide, nitric oxide, and glyceryl trinitrate.
Can J Physiol Pharmacol
75:
1034-1037,
1997[ISI][Medline].
17.
Kaide, JI,
Zhang F,
Wei Y,
Jiang H,
Yu C,
Wang W,
Balazy M,
Abraham NG,
and
Nasjletti A.
Carbon monoxide of vascular origin attenuates the sensitivity of renal arterial vessels to vasoconstrictors.
J Clin Invest
107:
1163-1171,
2001[ISI][Medline].
18.
Kharitonov, VG,
Sharma VS,
Pilz RB,
Magde D,
and
Koesling D.
Basis of guanylate cyclase activation by carbon monoxide.
Proc Natl Acad Sci USA
92:
2568-2571,
1995
19.
Kozma, F,
Johnson RA,
Zhang F,
Yu C,
Tong X,
and
Nasjletti A.
Contribution of endogenous carbon monoxide to regulation of diameter in resistance vessels.
Am J Physiol Regulatory Integrative Comp Physiol
276:
R1087-R1094,
1999
20.
Le Cras, TD,
and
McMurtry IF.
Nitric oxide production in the hypoxic lung.
Am J Physiol Lung Cell Mol Physiol
280:
L575-L582,
2001
21.
Liu, H,
Song D,
and
Lee SS.
Role of heme oxygenase-carbon monoxide pathway in pathogenesis of cirrhotic cardiomyopathy in the rat.
Am J Physiol Gastrointest Liver Physiol
280:
G68-G74,
2001
22.
Luo, B,
Abrams GA,
and
Fallon MB.
Endothelin-1 in the rat bile duct ligation model of hepatopulmonary syndrome: correlation with pulmonary dysfunction.
J Hepatol
29:
571-578,
98.
23.
Marks, GS,
Brien JF,
Nakatsu K,
and
McLaughlin BE.
Does carbon monoxide have a physiological function?
Trends Pharmacol Sci
12:
185-188,
1991[Medline].
24.
Martin, PY,
Ohara M,
Gines P,
Xu DL,
St John J,
Niederberger M,
and
Schrier RW.
Nitric oxide synthase (NOS) inhibition for one week improves renal sodium and water excretion in cirrhotic rats with ascites.
J Clin Invest
101:
235-242,
1998[ISI][Medline].
25.
Morita, T,
and
Kourembanas S.
Endothelial cell expression of vasoconstrictors and growth factors is regulated by smooth muscle cell-derived carbon monoxide.
J Clin Invest
96:
2676-2682,
1995[ISI][Medline].
26.
Nathan, C.
Nitric oxide as a secretory product of mammalian cells.
FASEB J
6:
3051-3064,
1992[Abstract].
27.
Nelson, RS,
and
Eichinger MR.
Role of nitric oxide (NO) in pulmonary dysfunction associated with experimental cirrhosis.
Respir Physiol
126:
65-74,
2001[ISI][Medline].
28.
Nunes, H,
Lebrec D,
Mazmanian M,
Capron F,
Heller J,
Tazi KA,
Zerbib E,
Dulmet E,
Moreau R,
Dinh-Xuan AT,
Simonneau G,
and
Hervé P.
Role of nitric oxide in hepatopulmonary syndrome in cirrhotic rats.
Am J Respir Crit Care Med
164:
879-885,
2001
29.
Rairigh, RL,
Le Cras TD,
Ivy DD,
Kinsella JP,
Richter G,
Fan I,
and
Abman SH.
Role of inducible nitric oxide synthase in regulation of pulmonary vascular tome in the late gestation ovine fetus.
J Clin Invest
101:
15-21,
1998[ISI][Medline].
30.
Rairigh, RL,
Storme L,
Parker TA,
Le Cras TD,
Markham N,
Jakkula M,
and
Abman SH.
Role of neuronal nitric oxide synthase in regulation of vascular and ductus arteriosus tone in ovine fetus.
Am J Physiol Lung Cell Mol Physiol
278:
L105-L110,
2000
31.
Ramos, KS,
Lin H,
and
McGrath JJ.
Modulation of cyclic guanosine monophosphate levels in cultured aortic smooth muscle cells by carbon monoxide.
Biochem Pharmacol
38:
1368-1370,
1989[ISI][Medline].
32.
Rolla, G,
Brussino L,
Colagrande P,
Scappaticci E,
Morello M,
Bergerone S,
Ottobrelli A,
Cerutti E,
Polizzi S,
and
Bucca C.
Exhaled nitric oxide and impaired oxygenation in cirrhotic patients before and after liver transplantation.
Ann Intern Med
129:
375-378,
1998
33.
Schmidt, HHHW,
and
Walter U.
NO at work.
Cell
78:
919-925,
1994[ISI][Medline].
34.
Verma, A,
Hirsch DJ,
Glatt CE,
Ronnett GV,
and
Snyder SH.
Carbon monoxide: a putative neural messenger.
Science
259:
381-384,
1993
35.
Wang, R,
Wang Z,
and
Wu L.
Carbon monoxide-induced vasorelaxation and the underlying mechanisms.
Br J Pharmacol
121:
927-934,
1997[ISI][Medline].
36.
Wang, R,
and
Wu L.
The chemical modification of KCa channels by carbon monoxide in vascular smooth muscle cells.
J Biol Chem
272:
8222-8226,
1997
37.
Wang, R,
Wu L,
and
Wang Z.
The direct effect of carbon monoxide on KCa channels in vascular smooth muscle cells.
Pflügers Arch
434:
285-291,
1997[ISI][Medline].
This article has been cited by other articles:
![]() |
R. Rodriguez-Roisin and M. J. Krowka Hepatopulmonary Syndrome -- A Liver-Induced Lung Vascular Disorder N. Engl. J. Med., May 29, 2008; 358(22): 2378 - 2387. [Full Text] [PDF] |
||||
![]() |
D. Morse and A. M. K. Choi Heme Oxygenase-1: From Bench to Bedside Am. J. Respir. Crit. Care Med., September 15, 2005; 172(6): 660 - 670. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Imamura, B. Luo, J. Limbird, A. Vitello, M. Oka, D. D. Ivy, I. F. McMurtry, C. V. Garat, M. B. Fallon, and E. P. Carter Hypoxic pulmonary hypertension is prevented in rats with common bile duct ligation J Appl Physiol, February 1, 2005; 98(2): 739 - 747. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Rodriguez-Roisin, M.J. Krowka, Ph. Herve, M.B. Fallon, and on behalf of the ERS Task Force Pulmonary-Hepatic Pulmonary-Hepatic vascular Disorders (PHD) Eur. Respir. J., November 1, 2004; 24(5): 861 - 880. [Full Text] [PDF] |
||||
![]() |
B. Luo, L. Liu, L. Tang, J. Zhang, Y. Ling, and M. B. Fallon ET-1 and TNF-{alpha} in HPS: analysis in prehepatic portal hypertension and biliary and nonbiliary cirrhosis in rats Am J Physiol Gastrointest Liver Physiol, February 1, 2004; 286(2): G294 - G303. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Zhang, J. I. Kaide, L. Yang, H. Jiang, S. Quan, R. Kemp, W. Gong, M. Balazy, N. G. Abraham, and A. Nasjletti CO modulates pulmonary vascular response to acute hypoxia: relation to endothelin Am J Physiol Heart Circ Physiol, January 1, 2004; 286(1): H137 - H144. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Miyazono, C. Garat, K. G. Morris Jr., and E. P. Carter Decreased renal heme oxygenase-1 expression contributes to decreased renal function during cirrhosis Am J Physiol Renal Physiol, November 1, 2002; 283(5): F1123 - F1131. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |