AJP - Lung Fuel your research with LabChart
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Lung Cell Mol Physiol 283: L636-L647, 2002. First published April 26, 2002; doi:10.1152/ajplung.00496.2001
1040-0605/02 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
283/3/L636    most recent
00496.2001v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (6)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Smith, J. B.
Right arrow Articles by Rovai, L. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Smith, J. B.
Right arrow Articles by Rovai, L. E.
Vol. 283, Issue 3, L636-L647, September 2002

Glucocorticoid-attenuated response genes induced in the lung during endotoxemia

Jeffrey B. Smith1, Tam T. Nguyen1, Heather J. Hughes1, Harvey R. Herschman2, Daniel P. Widney1, Kim C. Bui1, and Leonor E. Rovai1

1 Department of Pediatrics, UCLA School of Medicine and Mattel Children's Hospital at UCLA; and 2 Departments of Biological Chemistry and Molecular Pharmacology, and Molecular Biology Institute, University of California, Los Angeles, California 90095


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

Cytokines and other mediators whose induction in inflammatory lung disease is attenuated by glucocorticoids are potential targets for development of selective anti-inflammatory treatments. We refer to genes with these regulatory characteristics as glucocorticoid-attenuated response genes, or GARGs. Systematic identification of GARGs has not been attempted previously in vivo. Using an endotoxemia model in adrenalectomized mice, we constructed a subtracted lung library enriched in endotoxemia-induced genes and identified candidate GARGs by differential hybridization screening. Northern analysis confirmed induction in the lung during endotoxemia and attenuation by glucocorticoids of 36 genes of diverse types. The majority were genes of unknown function not previously implicated in the pulmonary response to inflammation, including a new member of a 2'-5'-oligoadenylate synthetase-like family and a novel lung inducible Neuralized-related C3HC4 RING protein. Our results suggest that a full understanding of glucocorticoid effects on lung inflammation will require elucidation of the roles of an extensive network of glucocorticoid-modulated genes.

gene expression; inflammation; lipopolysaccharide; molecular cloning; mouse model


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

INFLAMMATION IS REGULATED, in part, by the anti-inflammatory actions of the adrenal glucocorticoid hormones. Even at physiological concentrations in unstressed animals, glucocorticoids exert an important restraining effect on inflammatory responses (40, 41). Systemic stress causes increased secretion of glucocorticoids, which help to limit the injury potentially caused by uncontrolled activation of inflammatory mediators. Adrenalectomy sensitizes animals to the lethal effects of endotoxin, interleukin (IL)-1beta , tumor necrosis factor (TNF)-alpha , and viral infection, but increased glucocorticoid receptor gene dosage or pretreatment with glucocorticoids is protective (7, 38, 50, 53). Because of their broad and powerful anti-inflammatory effects, glucocorticoids have remained important agents in the treatment of many inflammatory diseases, including asthma, for nearly a half century.

Inflammation is also thought to have important roles in the pathophysiologies of bronchopulmonary dysplasia (BPD) in neonates (14, 29, 60) and of acute respiratory distress syndrome (ARDS) (11, 68, 70). Demonstrable short-term improvements in respiratory function, sometimes dramatic, resulted in widespread use of postnatal glucocorticoids for attempted prevention or treatment of BPD during the past decade. Improvement in long-term outcome has not been demonstrated, however. Because of the potential for serious adverse effects, including neurodevelopmental impairment, the routine use of corticosteroids for prevention or treatment of BPD in preterm infants is no longer recommended (3, 4, 6, 20). The results of using glucocorticoids for prevention or treatment of acute ARDS have also been disappointing (11, 68, 70), although a large multicenter trial is currently evaluating the use of glucocorticoids in the late, fibrosing phase of ARDS. The limited effectiveness of glucocorticoids in BPD and ARDS may be due, in part, to adverse effects of glucocorticoids on lung growth and repair that negate the potential benefits of reduced lung inflammation. If specific sets of inflammatory mediators important in the pathophysiology of these diseases could be identified, it might be possible to develop selective anti-inflammatory treatments that are safer and more effective.

One approach to finding new targets for anti-inflammatory treatments of lung diseases may be to identify lung-expressed genes whose activity is modulated by glucocorticoids. Although other mechanisms also contribute, a major part of the anti-inflammatory actions of glucocorticoids is attributed to their ability to attenuate the induction of genes encoding a variety of mediators important in inflammatory and immune responses (1, 5). Glucocorticoids inhibit the induction of the inducible form of prostaglandin H synthetase (cyclooxygenase 2), the inducible form of nitric oxide synthetase, and numerous inflammatory cytokines and chemokines including IL-1, TNF-alpha , and IL-8 (1, 5, 58). We refer to inflammatory stimulus-induced genes whose message expression is attenuated by glucocorticoids as glucocorticoid-attenuated response genes, or GARGs.

We previously suggested that there are many GARGs not yet described and tested that hypothesis in a cell culture model (58). Before that study, all of the known GARGs had been identified either via assays of their biological activity or by procedures based on screening for inducibility. In each case, glucocorticoid attenuation was investigated after the gene or its product had been identified. In our study, differential hybridization screening of a Swiss 3T3 cell library identified 12 different lipopolysaccharide (LPS)-inducible GARG cDNAs (58). Five were previously undescribed murine sequences, including a new chemokine, LPS-induced C-X-C chemokine, or LIX (58). The high proportion of new sequences identified in that small-scale screening supported the hypothesis that many GARGs remained to be identified. We subsequently verified that endotoxemia-induced LIX expression was strongly glucocorticoid attenuated in the lungs of adrenalectomized (ADX) mice (51). In contrast, the related chemokines KC and macrophage inflammatory protein (MIP)-2 were LPS induced but not glucocorticoid attenuated in the lungs of the ADX or normal mice, despite the ability of glucocorticoids to attenuate the induction of KC and MIP-2 induction in cell culture studies. These results emphasized the importance of in vivo studies for determining which genes are subject to attenuation by glucocorticoids in specific models of lung inflammation.

The goal of the present study was to identify GARGs induced in the lung during endotoxemia. We hoped to identify novel genes, as well as genes not previously implicated in lung inflammation, as candidates for further study in other models. We also hoped to gain a better understanding of characteristics of the GARG class as a whole. An advantage of the endotoxemia model for this study is that intravenous injection of LPS triggers the prompt release of endogenous mediators including TNF-alpha , IL-1beta , and interferon (IFN)-gamma , so downstream genes responsive to these mediators, as well as those directly responsive to LPS, are induced. Although the timing and pattern of gene expression will differ in specific disease models, many of the genes induced during endotoxemia are expected to participate in a wide variety of acute and chronic inflammatory lung diseases. ADX mice were used for the screening to eliminate the effects of endogenous glucocorticoids and maximize potential message attenuation in response to an exogenous steroid. The expression characteristics of candidate GARG cDNAs were evaluated in normal as well as ADX mice.

Anticipating that GARG messages would constitute only a small fraction of the total mRNA population in the lung, we used a two-stage screening strategy. First, a subtracted library enriched in endotoxemia-induced genes was constructed with lung RNA from ADX mice. The library was then screened by differential hybridization to select candidate GARG clones. Northern analysis confirmed glucocorticoid attenuation of endotoxemia-induced lung expression for 36 GARG cDNAs. The majority were genes of unknown function not previously implicated in the pulmonary response to inflammation. Four were new murine sequences, including the murine ortholog of the human IFN-inducible T-cell alpha -chemoattractant (I-TAC) chemokine (CXCL11), as we reported previously (71), and a new member of the guanylate binding protein (GBP) family, murine GBP-5. We report here the complete cDNA sequences of a new member of the 2'-5'-oligoadenylate synthetase-like family (murine OASL-2), and a novel lung-inducible Neuralized-related C3HC4 RING domain protein (LINCR) and its predicted human homolog. The results of this study indicate that the network of glucocorticoid-attenuated genes participating in the lung response to endotoxemia is much more extensive and diverse than previously thought.


    METHODS
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

Animals. ADX, sham-operated, and nonoperated male Swiss-Webster mice purchased from Charles River Laboratories (Cambridge, MA) were studied at 8-12 wk of age and at least 2 wk after operation. Mice were housed under specific pathogen-free conditions in the UCLA Health Sciences Center vivarium for at least 1 wk before experimental manipulation. ADX mice were supplied with normal saline instead of water to drink. All procedures were performed in accordance with protocols approved by the UCLA animal care and use committee.

Sterile, tissue culture-certified LPS prepared by phenol extraction and gel filtration from Escherichia coli serotype O111:B4 was obtained from Sigma (St. Louis, MO). Preservative- and pyrogen-free saline (Abbott Laboratories, North Chicago, IL) was used for dilution of LPS and for control injections. Dexamethasone sodium phosphate (Dex, 4 mg/ml of dexamethasone phosphate equivalent) for injection was obtained from Elkins-Sinn (Cherry Hill, NJ). LPS (50 µg in 200 µl of sterile saline) or saline alone was injected via the tail vein. Two 400-µg doses of Dex in 100 µl of saline or saline alone were injected subcutaneously 18-20 h before and 5 min before LPS. Lungs and other organs were harvested for RNA preparation as described (51).

Construction of subtracted library. A cDNA population enriched in endotoxemia-induced messages was generated using the suppression subtraction hybridization (SSH) technique (17, 18). Lung RNA for the "tester" population was prepared from ADX mice killed 1, 2, or 4 h after tail vein injection of LPS (4-5 mice per group). Lung RNA for the "driver" population was prepared from ADX mice treated with two doses of Dex as above, and the mice were killed 1, 2, and 4 h after the second dose (4 mice per group). Poly-A-selected RNAs were prepared from the pooled tester and pooled driver RNAs using the PolyATtract I kit (Promega, Madison, WI). After first- and second-strand synthesis, the tester and driver cDNAs were digested with RsaI, and aliquots of the tester cDNA were separately ligated to the SSH adapters I and II from the PCR-Select cDNA Subtraction Kit (Clontech, Palo Alto, CA). Sequential 7- and 16-h hybridizations of the driver with the adapted tester cDNAs and PCR amplification of the subtracted cDNAs were performed as described in the PCR-Select manual.

The PCR-amplified subtracted cDNAs had an XmaI site and an EagI site at opposite ends of the cDNA insert within adapter-derived sequences. The subtracted cDNAs were sequentially digested with XmaI and EagI and then ligated to EcoRI-SalI-XmaI and XhoI-NcoI-EagI adapters we designed. The EcoRI-SalI-XmaI adapter was prepared by annealing nonphosphorylated AATTCTCCAGCGTGTCGACT with 5'-phosphorylated CCGGAGTCGACACGCTGGAG. Nonphosphorylated TCGAGTGCTGTGTAGGTATCCAT and 5'-phosphorylated GGCCATGGATACCTACACAGCAC were annealed to generate the XhoI-NcoI-EagI adapter. After the ligation, we removed excess adapters and short cDNAs by passing the reaction mixture over Chromaspin-200 columns (Clontech) three times. The adapted cDNAs using T4 kinase (New England Biolabs), ligated to EcoRI- and XhoI-digested lambda  Zap II (Stratagene, La Jolla, CA), and packaged with Gigapack Gold III (Stratagene) were then phosphorylated. The primary library, containing 4 × 105 phage (95% recombinants), was amplified once. The cDNA insert sizes of 18 randomly selected phages ranged from 460 to 1,230 nt (mean 630).

Phage screening and analysis. Diluted aliquots from the subtracted library were plated at a density of approx 950 plaques per 150-mm petri dish. One additional dish was plated with approx 200 plaques. Each plate was also inoculated at specific locations with plaque-pure control phages containing inserts of LIX, monocyte chemoattractant protein (MCP)-1, and ribosomal protein S2 (rpS2) cDNA. Poly-A-selected RNA for the "LPS probe" was prepared from pooled lung RNA from 10 ADX mice killed 2 h after LPS injection. RNA for the "LPS-Dex" probe was from lungs of 12 ADX mice pretreated with two doses of Dex and killed 2 h after LPS. RNA for the control probe was from lungs of Dex-treated ADX mice. Replicate filter lifts, cDNA probe synthesis, and hybridization were performed as described (59).

For PCR, candidate phages were replated at low density. We amplified inserts from well-separated progeny plaques using vector primers TAATACGACTCACTATAGGG and ATTAACCCTCACTAAAGGGA or using primer pairs targeted to the EcoRI-SalI-XmaI and XhoI-NcoI-EagI adapter sequences. Primers jDW (GTCGACTCCGGGCAGGT) and jDX (AGGTATCCATGGCCGAGGT) terminate at the junction between the subtracted cDNAs and the SSH adapters I and II, so RsaI digestion of jDW/jDX-amplified inserts removed all adapter-derived sequences from the ends of the cDNA. To amplify inserts lacking the RsaI junction, such as those derived from cDNAs cut by EagI or XmaI during the cloning process, we used the primers jE5 (GAATTCTCCAGCGTGTCGACT) and jE6 (TCGAGTGCTGTGTAGGTATCCAT). Digestion of jE5/jE6-amplified inserts with SalI and NcoI left 8-16 nt of adapter-derived sequences on the ends of the cDNAs. An annealing temperature of 60°C was used for all three primer pairs. The ends of vector primer-amplified cDNA inserts were sequenced with adapter primers jDW or jE5 and with jDX or jE6.

Analysis of candidate phages was performed in stages. First, inserts were amplified by PCR from 42 plaques (group 1) that were >= 3 mm from the nearest neighbor on the low-density phage filter. To identify redundant phages within group 1, we hybridized replicate filter arrays of the phage inserts with selected insert probes. Group 1 replicates among the remaining candidates were identified by hybridizing a replicate filter from the library screening with pooled group 1 probes (after removal of adapter sequences). Among the 83 remaining candidates, the 32 group 2 plaques were those whose nearest neighbor was >= 1 mm distant and for which the major plaque component could be identified unambiguously by PCR. The 35 candidates remaining after elimination of group 2 replicates were plaque purified by differential hybridization (group 3).

Full-length cDNAs. A nonsubtracted cDNA library in lambda  Zap II, prepared from lung RNA of LPS-treated ADX mice as described (71), was screened by hybridization with the candidate LINCR insert. Potential full-length phages were converted to plasmid form and sequenced. IMAGE Consortium (37) clones for OASL-2 and human LINCR were obtained from Incyte Genomics (Palo Alto, CA).

Northern analysis and ribonuclease protection assay. Northern analysis of total cellular RNA, 10 µg/lane, was performed as described (51, 58). Autoradiographic signal intensities were quantitated by PhosphorImaging (Molecular Dynamics, Sunnyvale, CA). Corrections for lane-to-lane variations in loading were made using the signal intensity of the same filter reprobed with rpS2. We verified that LPS and Dex did not affect lung expression of rpS2 message under the conditions used in this study (51, 71). Signal intensities for IFN-gamma and IL-6 were determined by ribonuclease protection assay (MCK-1 probe set; BD Pharmingen, San Diego, CA) and corrected for loading variations using the rpL32 signal.

Sequence analysis. Sequence analysis and contig assembly were performed with MacVector and AssemblyLign (Accelrys, Madison, WI). We performed multiple alignment and phylogenetic analysis using Clustal W (64) and drew tree diagrams from the Clustal W output using TreeView (43). The human LINCR cDNA was predicted from genomic sequences using the GENSCAN (12) and Fgenes (http:// genomic.sanger.ac.uk/) programs. We determined the positions of ubiquitin-like domains in the OASL proteins by searching the National Center for Biotechnology Information conserved domain database (2).


    RESULTS
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

Identification of candidate GARG cDNAs. To identify candidate GARG cDNAs, we constructed a subtracted library enriched in endotoxemia-induced genes and then screened the library by differential hybridization. The subtraction was performed using the SSH technique (17, 18), as described in METHODS. The tester and driver were RsaI-digested cDNA populations prepared from lung RNA of LPS-treated and of Dex-treated ADX mice, respectively. The differential hybridization screening was performed by hybridizing replicate filter lifts of the subtracted library phage with 1) an LPS cDNA probe synthesized from lung RNA of ADX mice killed 2 h after intravenous injection of LPS, 2) an LPS-Dex probe from lung RNA of ADX mice pretreated with Dex and killed 2 h after intravenous injection of LPS, and 3) a control cDNA probe from lung RNA of ADX mice treated with Dex. The criteria for selection of GARG candidate phage plaques were 1) increased signal density on the LPS filter compared with the control filter (induction during endotoxemia) and 2) decreased signal on the LPS-Dex filter compared with the LPS filter (glucocorticoid attenuation). More than 90% of the library clones screened satisfied the first criterion, verifying that the library was highly enriched in endotoxemia-induced genes. From a screening of 6,600 plaques, we identified 599 candidate GARG phage satisfying both criteria (9% of the phage screened).

The candidate phage were analyzed in three stages (see METHODS). The 42 group 1 clones yielded cDNAs for 12 different genes, 10 of which were subsequently confirmed as GARGs by Northern analysis (below). The group 2 and group 3 clones yielded 19 and 24 additional genes, respectively, of which 13 in each group were confirmed as GARGs. In accordance with the expectation that the randomly picked group 1 clones were likely to be those most abundant in the subtracted library, all had been cloned previously. There were two novel cDNAs (GBP-5 and LINCR) in group 2 and two (I-TAC and OASL-2) in group 3. Because of the method used to eliminate replicate phage, the abundances of clones for the cDNAs in groups 1 and 2 were not determined. However, 11 of the 13 confirmed group 3 GARGs were represented by a single clone. The large proportion of single isolates among the group 3 clones indicates that the screening was not exhaustive.

Candidate gene expression in normal and ADX mice. To confirm the identification of GARG cDNAs and eliminate false positives among the 55 final candidates, we evaluated their expression characteristics by Northern analysis. First, induction during endotoxemia and attenuation by Dex of all candidates were evaluated in normal (nonoperated) mice. Our criteria for a GARG message were 1) an endotoxemia-induced increase in lung message expression of twofold or more and 2) attenuation by Dex of 25% or more of the endotoxemia-induced increase. Thirty-five of the 55 candidate cDNAs met both of these criteria in normal mice (Table 1).

                              
View this table:
[in this window]
[in a new window]
 
Table 1.   Identities and expression characteristics of confirmed GARG messages

Next, we evaluated the effect of adrenalectomy on the expression characteristics of the remaining candidates. We hoped that for some of these candidates, the absence of endogenous glucocorticoids in ADX mice would allow detection of attenuation by Dex, as we had previously observed for LIX (51). A selection of candidates already confirmed as GARGs in normal mice was also studied in this second, independent experiment comparing normal, ADX, and sham-ADX mice. First, we evaluated the expression of LIX and the novel cDNA LINCR using Northern blots containing individual RNA samples from all mice in each treatment group (Fig. 1A). Although LIX expression in sham-operated and normal mice was similar, the endotoxemia-induced expression of LIX was 10.3-fold greater in ADX mice than the level expressed during endotoxemia in normal mice. Dex attenuated the LPS-induced expression in ADX mice to a level comparable with that of LPS-treated normal mice (with or without Dex), confirming the results of our previous study (51). In contrast to LIX, endotoxemia-induced LINCR message was not increased in ADX compared with normal and sham-operated mice and was attenuated by Dex to a similar extent in all three groups of mice. The remaining candidates and a number of the GARG cDNAs already identified were evaluated by replicate Northern blots of pooled RNA samples (Table 1, Fig. 1B).


View larger version (38K):
[in this window]
[in a new window]
 
Fig. 1.   Lung message expression of representative glucocorticoid-attenuated response gene (GARG) cDNAs. Lung RNA from normal (nonoperated), adrenalectomized (ADX), and sham-operated mice was collected 4 h after lipopolysaccharide (LPS) injection with or without dexamethasone (Dex) pretreatment (5 mice/group). A: LPS-induced message expression of LPS-induced X-X-C chemokine (LIX) was enhanced 10-fold in ADX mice, but adrenalectomy did not affect LPS induction of lung inducible Neuralized-related C3HC4 RING protein (LINCR). A Northern blot containing lung RNA from each mouse was sequentially hybridized with probes for LIX, LINCR, and ribosomal protein (rp) S2, and quantitated as described in METHODS. For each gene, data were scaled so that the mean message level in LPS-treated normal mice equaled 1.0 (dotted line). Error bars indicate the SE. B: replicate Northern blots of pooled lung RNA specimens were hybridized with probes for GARG candidates, and then with an rpS2 probe. Cig, cytomegalovirus-induced gene; GBP, guanylate binding protein; IGTP, IFN-gamma -induced GTPase; IL, interleukin; IP, interferon (IFN)-gamma -inducible protein; IRF, IFN regulatory factor; I-TAC, IFN-inducible T-cell alpha -chemoattractant; MCP, monocyte chemoattractant protein; MIG, monocyte induced by IFN-gamma ; OASL, oligoadenylate synthetase like.

All of the candidates tested that met the criteria for GARGs in normal mice in the first experiment were confirmed as GARGs in both normal and ADX mice in this second, independent experiment. Only one additional candidate, P-selectin, was identified as glucocorticoid-attenuated in ADX mice but not normal mice, bringing the total of confirmed GARGs isolated in the screening to 36. However, the evaluation revealed marked differences in the effects of adrenalectomy on LPS-induced expression among GARGs. Adrenalectomy produced marked enhancement of LPS-induced expression of LIX (10-fold) and IL-6 (eightfold) and twofold or greater enhancement of LPS-induced expression of intracellular adhesion molecule (ICAM)-1, P-selectin, IL-1beta , MCP-1, MIP-1alpha , and IFN-inducible GTPase (IIGP). The ADX-enhanced LPS-induced expression of these genes was reduced by Dex to levels similar to those in LPS-Dex-treated normal and sham-operated mice (Fig. 1), which indicates that the enhancement of LPS-induced expression in ADX mice was due to loss of the endogenous glucocorticoid response and not to other effects of adrenalectomy.

Characteristics of the GARG cDNAs. The 36 GARG cDNAs identified in this study include diverse categories of genes (Table 1). Although all were induced by LPS and attenuated by Dex, they exhibited wide quantitative differences in responses to LPS and Dex in normal mice and qualitative differences in the effect of adrenalectomy. IFN-gamma , IL-6, LIX, and monokine induced by IFN-gamma (MIG), previously identified as GARGs and included in Table 1 for comparison, were not among the 36 cDNAs identified in the screen. This provides a further indication that the screening was not exhaustive. Four of the cDNAs cloned in the GARG screening were new murine sequences: I-TAC, GBP-5, OASL-2, and LINCR. Our results for murine I-TAC were reported previously (71). The sequence features and expression characteristics of murine GBP-5, a new member of the GBP family of large GTPases (46, 72), will be described separately (T. T. Nguyen and J. B. Smith, unpublished data). The complete cDNA sequences of OASL-2 and LINCR are described below.

Our screening focused on genes expressed in the lung but was not designed to select lung-specific genes. Message expression of 15 GARGs was evaluated in brain, lung, heart, liver, spleen, kidney, small intestine, and skeletal muscle. Except for OASL-2 and LINCR (discussed below), expression levels were low or undetectable in all organs of control mice. All 15 GARGs evaluated were substantially induced in at least two other organs in addition to the lung, and most were detectably induced in all organs examined (not shown). We conclude that most GARGs expressed in the lung during endotoxemia are not lung specific.

Identification of a new OASL gene, murine OASL-2. One of the group 3 clones had an incomplete open reading frame with similarity to the human 2'-5'-OASL and murine M1204/OASL-p54 proteins (26, 49, 65). We refer to M1204 and its presumed alternative splice form (GenBank AK010034) as murine OASL-1. To clarify the relationship of our partial cDNA to these genes, we searched the GenBank expressed sequence tag database and identified what proved to be a full-length OASL-2 cDNA (IMAGE clone 3661036). The complete sequence was assigned GenBank accession number AF426289. The OASL-2 cDNA is 2,070 nt, including a 15-nt poly-A tail after the consensus polyadenylation signal AATAAA at nt 2,031-2,036. The cDNA contains a 1,533-nt open reading frame encoding the 511-amino acid (AA) residue OASL-2 protein, which has a molecular mass of 59 kDa and a predicted isoelectric point of 7.53. The initiating ATG at nt 27-30 is the first ATG in the sequence and occurs in the context GCCatgG, which matches the strong consensus context (A/G)NNatgG for translation initiation (32). Murine OASL-2 message was induced >100-fold in lungs of LPS-treated mice and attenuated by Dex (Table 1, Fig. 1). The approx 2.5-kb message was expressed in the small intestine of control mice and strongly induced during endotoxemia in the heart, liver, spleen, small intestine, and kidneys (not shown), as well as in the lung (Fig. 1).

The murine OASL-2 and human OASL proteins are highly similar throughout their lengths (Fig. 2), containing 71% identical and 83% similar AA residues. In contrast, murine OASL-2 and OASL-1 share only 45% identical and 18% similar residues. Like the other OASL family members (Fig. 3A), murine OASL-2 contains a approx 340-residue amino terminal domain similar to human 2'-5'-oligoadenylate synthetase 1 (OAS-1). Human OAS-1 consists largely of a single OAS domain (Fig. 3A), whereas OAS-2 has two and OAS-3 has three tandem OAS repeats (not shown). The OASL domains of the OASL family members are 37-43% identical to human OAS-1. In contrast, the murine OAS-1 and human OAS-1 proteins are 67% identical.


View larger version (92K):
[in this window]
[in a new window]
 
Fig. 2.   Alignment of human (Hu.) and murine (Mu.) OASL protein sequences. Residues identical in 2 or more of the proteins are shown in reverse type. Residues similar in 2 or more are boxed. Indicated above the aligned sequences are the OASL and ubiquitin-like (Ub) domains, the positions of the LxxxP, P-loop, ATP-binding, and CFK motifs implicated in the activity of oligoadenylate synthetases, and 2 regions of unknown function highly conserved among the oligoadenylate synthetase (OAS) and OASL proteins (see Ref. 26). The Ub domain boundaries are those of human OASL (p59 form, GenBank CAA12396). The predicted COOH-terminal ends of the Ub domains differ slightly in murine OASL-2 (GenBank AF426289) and OASL-1 (see Fig. 3A). The M1204/OASL-p54 form (AF068835) of murine OASL-1 is identical to the sequence shown (AK010034) through G-468 (*) and then terminates after 5 additional residues.



View larger version (36K):
[in this window]
[in a new window]
 
Fig. 3.   Domain structure and phylogenetic tree of OASL and OAS proteins. A: diagram of the OASL proteins, showing the NH2-terminal OASL region and the two COOH-terminal Ub domains, compared with human 2'-5' oligoadenylate synthetase 1 (OAS1). The number of amino acid residues in each protein is indicated at the right. B: phylogenetic tree of OASL and OAS proteins. The diagrams and phylogenetic analysis used the following sequences: human OASL (p59 form, GenBank CAA12396), murine OASL-1 (AK010034), murine OASL-2 (AF426289), chicken OASL (OAS-A, AB037593), human OAS-1 (D00068), pig OAS1 (AJ225090), murine OAS1 (X04958), rat OAS1 (Q05961), OAS domains 1 and 2 of human OAS-2 (P29728), and OAS domains 1-3 of human OAS-3 (Q9Y6K5).

The COOH-terminal regions of the murine and human OASL proteins consist of two tandem ubiquitin-like domains not present in the OAS proteins in these species (Fig. 3A). The protein we refer to as chicken OASL, encoded by what was originally described as the chicken OAS-A gene, has a similar pair of ubiquitin-like domains in its COOH-terminal region (62, 73). The exon-intron structures of this chicken gene and human OASL are identical (62). A phylogenetic analysis of the OASL and OAS-1 proteins in several species, plus the individual OAS domains of human OAS-2 and OAS-3, confirms the close relationship of murine OASL-2 to human OASL (Fig. 3B). The murine and human OASL proteins cluster in a distinct subgroup adjacent to chicken OASL. The preservation of high similarities among the human, murine, and chicken OASL genes suggests that their COOH-terminal ubiquitin-like domains have an important, conserved function.

Identification of a novel Neuralized-related RING domain protein, LINCR. The LINCR cDNA was represented by a single group 2 candidate clone containing a 2,078-nt insert with an incomplete open reading frame at the 5'-end. Northern blotting using the insert as a probe identified a single 2.8-kb band in lung RNA from LPS-treated mice. Basic local alignment search tool (BLAST) searching revealed no significant matches to known sequences. Four full-length LINCR clones were obtained by screening a nonsubtracted library prepared from the same RNA used for the tester population of the subtracted library. Two clones were completely sequenced on both strands and were identical except for a silent polymorphism at nt 105 of the 2,588-nt consensus sequence, which includes a 15-nt poly-A tail. The LINCR sequence was assigned GenBank accession number AF321278. The sequence contains a 762-nt open reading frame encoding the predicted LINCR protein and a 1,759-nt 3'-untranslated region with a single AUUUA sequence, associated with rapid message degradation (54) at 1,111-1,115. The first ATG in the sequence, at 61-63, occurs in the context CTGatgG, which is adequate for translation initiation (32). In contrast, the next ATG, at 89-91, is in the context CCAatgC, which is highly unfavored. Identification of ATG 61-63 as encoding the initiating methionine is also supported by the similarities, described below, between LINCR and other conserved proteins. In contrast, translations of other open reading frames in the LINCR cDNA had no detectable homology to other proteins in any species. There is no in-frame upstream stop codon before ATG 61-63, so the possibility of an upstream ATG not included in the LINCR cDNA sequence cannot be ruled out entirely. However, the observed mRNA size of 2.8 kb is consistent with the 2,573-nt length of the cDNA plus a approx 200-nt poly-A tail.

The predicted murine LINCR protein contains 254 AA residues, with a molecular mass of 28 kDa and isoelectric point of 6.50. No transmembrane regions are predicted. The COOH-terminal region contains a C3HC4-type RING domain (21, 27, 28), with the spacing C-X(2)-C-X(11)-C-X(1)-H-X(3)-C-X(2)-C-X(10)-C-X(2)-C (Fig. 4). LINCR has sequence similarities to Drosophila Neuralized (Neur), human and murine homologs of Neur, and Caenorhabditis elegans F10D7.5 (10, 42, 47, 52). Each of these proteins contains a COOH-terminal RING domain with similar spacing and ~30% identity to the RING domain of murine LINCR. These proteins also contain two copies of a distinctive 153-156 AA region, the Neur repeat (NR) domain, Fig. 5A. In contrast, murine LINCR contains a single NR domain. In Neur and its homologs, the two NR domains are related but not identical. The first (NR1) and second (NR2) domains of murine Neur are only 25% identical to each other but are 97 and 95% identical, respectively, to the NR1 and NR2 domains in human Neur. The phylogenetic analysis shows that the single NR domain of murine or human LINCR occupies a position intermediate between the NR1 and NR2 domains of the other proteins (Fig. 5B). The murine and human LINCR domains are 27-33% identical to both the NR1 and NR2 domains of Drosophila Neur and C. elegans F10D7.5. However, the murine and human LINCR NR domains have greater similarity to the NR1 domains of the murine and human Neur proteins (39-41% identical) than to their NR2 domains (26-29% identical). This suggests that an ancestral mammalian LINCR gene may have evolved from a duplicated Neur gene by deletion of its second NR domain.


View larger version (28K):
[in this window]
[in a new window]
 
Fig. 4.   Alignment of the predicted murine and human LINCR protein sequences. Residues identical in the 2 proteins are in reverse type and similar residues are boxed. The Neur repeat and RING domains are indicated above the sequences. The conserved C and H residues of the RING domain are marked by bullets ( · ) below. The length and sequence of the NH2-terminal end of human LINCR (dashes) are uncertain.



View larger version (35K):
[in this window]
[in a new window]
 
Fig. 5.   Relationships of murine and human LINCR to Drosophila melanogaster Neur and similar proteins in other species. A: diagram of the Neur Repeat (NR) domains and RING (R) domains of the LINCR proteins compared with Neur proteins. The number of amino acid residues in each protein is indicated at the right. B: phylogenetic relationships of the single NR domain in murine and human LINCR with the 2 NR domains in the Neur proteins. Sequences used in the analysis were murine LINCR (AF321278), the predicted human LINCR sequence in Fig. 4, D. melanogaster Neur (S35503), human Neur (U87864), murine Neur (m-neu1, Y15160), and C. elegans F10D7.5 (T16028).

Murine LINCR mRNA was strongly induced in the lung during endotoxemia and attenuated by Dex (Table 1, Fig. 1). These characteristics were essentially unaffected by adrenalectomy or sham operation. However, expression of LINCR in saline-treated ADX mice was threefold higher than in normal or sham-operated mice (Fig. 1A), indicating that basal lung expression of LINCR is sensitive to the levels of glucocorticoids normally circulating in unstressed mice. LINCR mRNA was also induced in heart and kidney and was constitutively expressed in the small intestine (not shown). LINCR expression in the lung was evaluated 1, 2, 4, and 8 h after LPS injection and in controls (3 mice per group). After a rapid rise to a peak at 1 h, LINCR expression remained high for 4 h then decreased at 8 h to 50% of the initial peak value (not shown).

Identification of a predicted human LINCR homolog. A translated BLAST search of the GenBank draft human genome sequence database using the murine LINCR protein sequence identified a closely related gene on human chromosome 2p11 (GenBank NT026970.3). Analysis of the genomic sequence identified exons encoding the predicted sequence of human LINCR (Fig. 4). Within the region shown, human LINCR is 67% identical and 9% similar to murine LINCR. The NH2-terminal region of human LINCR is not shown in Fig. 4 because alternative exon predictions for this region could not be distinguished. To date, we have not identified a cDNA clone encoding the complete human LINCR. However, the portion of human LINCR shown in Fig. 4 is encoded by a segment of IMAGE clone 3346442 (GenBank BC012317). Despite our uncertainty about its amino terminal region, human LINCR is likely to be similar to murine LINCR in containing only a single NR domain, because no second NR domain occurs within the 60 kb of contiguous sequence upstream of this gene, or indeed anywhere in the available human chromosome 2 sequence.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

Glucocorticoid hormones act via the glucocorticoid receptor to modulate the expression of a large number of genes involved in inflammatory and immune responses and other processes (1, 39). This study focuses on the subset of genes whose induction in response to inflammatory stimuli is attenuated by glucocorticoids, which we refer to as GARGs to distinguish them from noninduced genes whose expression is reduced by glucocorticoids. Our underlying hypothesis is that GARG expression characteristics define a large subset of inflammation-related genes and that identifying and determining the functions of GARGs participating in specific disease processes will reveal new targets for therapeutic intervention.

The results of this study, the first to attempt the systematic identification of GARGs in an in vivo model, indicate that genes with these regulatory characteristics are numerous and diverse. As expected, some of the 36 cDNAs cloned and verified as GARGs by Northern analysis in this study (Table 1) represent well-known proinflammatory mediators, including IL-1beta , the chemokines IP-10, MCP-1, and MIP-1alpha , and adhesion proteins ICAM-1, P-selectin, and vascular cell adhesion molecule-1. The presence of suppressor of cytokine signaling-3, a negative feedback regulator of IFN-gamma signaling (31, 61), serves as an important reminder that anti- as well as proinflammatory mediators may have GARG expression characteristics. In addition, many of the cDNAs we cloned represent genes of unknown function or genes not previously associated with lung inflammation. Four were previously unknown sequences. All these genes are candidates for further study to determine their functional roles in lung disease models. The collection as a whole should also be useful in studies of the diverse molecular mechanisms by which glucocorticoids attenuate gene expression (1, 5).

The GARG cDNAs identified in this study represent diverse functional and structural categories of genes (Table 1). Half of these cDNAs were originally identified as IFN-inducible genes. These include the three members of the IFN-induced tetratricopeptide repeat domain family (p56 or IFN-inducible-56 family) cloned in our earlier GARG screening in 3T3 cells (13, 36, 57, 69) and multiple members of the GBP and IRG-47 families of IFN-inducible GTP-binding proteins (8, 25, 46, 66). It was recently demonstrated that the IRG-47 family member IFN-gamma -induced GTPase (Table 1) is involved in host resistance to Toxoplasma gondii (24, 63). Human GBP-1 and murine GBP-2 have recently been shown to modulate cell proliferation (22, 23). The chemokines IP-10 and MIG, which together with I-TAC form a distinct subgroup of C-X-C chemokines (71), were also originally cloned as IFN-inducible genes (19). The fact that a high proportion of the genes identified in this study were originally described as IFN-inducible genes may reflect, in part, the role of IFN-gamma release in endotoxemia. However, it may also be a reflection of the major efforts devoted to characterizing IFN-gamma -induced genes (9, 15), many of which are also induced by LPS or other inflammatory cytokines.

We used ADX mice for our screening to eliminate the effects of endogenous glucocorticoids and maximize potential message attenuation in response to an exogenous steroid. This choice was based on our previous studies of LIX, whose endotoxemia-induced expression in the lung and other tissues was glucocorticoid attenuated in ADX but not normal mice (51). In the present study, we found that all but one of the GARG cDNAs we identified were glucocorticoid attenuated in normal as well as ADX mice (Table 1). However, significant enhancements of endotoxemia-induced expression were observed for several genes in addition to LIX, including IL-6, ICAM-1, P-selectin, IL-1beta , MCP-1, MIP-1alpha , and IIGP (Table 1). ADX-induced enhancement of message expression has been described for IFN-gamma , IL-1beta , IL-6, and a few other cytokines in the spleen during murine cytomegalovirus infection (53) and for IL-1beta and IL-6 in spleens of LPS-treated rats (45, 55). Interestingly, the LPS-induced expression of the IFN-gamma -induced chemokines MIG and I-TAC was reduced 40-50% in ADX compared with normal and sham-operated mice (Table 1, Fig. 1), whereas expression of the closely related IFN-gamma -induced chemokine IP-10 was unaffected by adrenalectomy. The mechanisms responsible for these gene-specific effects of adrenalectomy have not been studied. Perhaps the genes showing the largest ADX-induced increases in LPS-induced expression are those most sensitive to attenuation by endogenous glucocorticoids at the levels induced during endotoxemia. Alternatively, the LPS-induced expression of specific genes might be affected by loss of adrenal catecholamines and increased norepinephrine secretion or by other compensatory responses to adrenalectomy.

The idea of finding new potential targets for anti-inflammatory treatments by identifying genes with GARG regulatory characteristics is applicable to other inflammatory models and is not limited to the specific techniques used in this study. Microarrays are now more widely available than at the time this study was initiated and would likely be the method of choice for future studies. Nevertheless, microarrays remain expensive and do not, as yet, provide true genome-wide coverage, so screening of subtracted libraries should continue to be valuable for certain applications. Some of the techniques developed for this study may be useful to other investigators. Although the subtracted cDNAs produced by the SSH procedure can be easily cloned into plasmid vectors, differential screening of lambda -phages is more sensitive and reproducible in our experience (59). Unfortunately, the standard SSH adapters do not include sites convenient for cloning into lambda . Rather than alter the SSH adapters, which might have unpredictable effects on the efficiency of the suppression PCR (17), we designed adapters that facilitated both the cloning into lambda  Zap II and, by incorporating convenient restriction and primer sites, the downstream analysis of phage inserts. The approaches we used to identify phage inserts by PCR and to eliminate redundant phage by hybridization avoided repeated differential screenings for plaque purification and greatly reduced sequencing costs.

One of the cDNAs we cloned encoded a new OASL gene (26, 49, 65), which we call murine OASL-2. The functions of the OASL genes are unknown, but the OASs have a well-defined function in a regulated RNA decay pathway involved in the antiviral and growth inhibitory effects of IFNs (30, 48, 56). When activated by double-stranded (ds) RNA, the OAS enzymes catalyze the production of a mixture of 2'-5'-linked oligomers of adenylate (2-5A), whose only known function is to activate the latent ribonuclease RNase L. RNase L activation requires 2-5A oligomers containing three or more adenylates.

The OASL genes contain an NH2-terminal OAS-like domain plus two characteristic COOH-terminal ubiquitin-like domains not present in the OAS genes (Figs. 2 and 3A). Intrinsic ubiquitin-like domains may participate in regulating the activity or stability of some proteins (26), but the role of the ubiquitin-like domains in the OASL proteins has not been determined. The function of the OAS domain in the OASL proteins is uncertain also. Neither the p-59 and p-56 forms of human OASL had any detectable 2-5A synthetase activity (26, 49). In contrast, murine OASL-1 (M1204 form) synthesized 2-5A dimers (incapable of activating RNase L) but not larger oligomers. The activity was not dependent on or enhanced by dsRNA, however. The protein we refer to as chicken OASL has OAS activity and was originally described as chicken OAS (62, 73). The sizes of the 2-5A oligomers produced by chicken OAS/OASL and requirement for activation by dsRNA were not reported, however. From an evolutionary point of view, it will be very interesting to determine whether the chicken genome contains orthologs of the mammalian OAS genes (lacking ubiquitin-like domains) in addition to the OAS/OASL gene. If not, this would suggest that the mammalian OAS family evolved by gene duplication from an ancestral vertebrate OASL gene.

Phylogenetic analysis indicates that the OASL-2 protein is closely related to human OASL (Fig. 3B). However, the expression patterns of these genes differ. We found that murine OASL-2 message was easily detected in the small intestine but not the spleen in control mice and, during endotoxemia, was strongly induced in the lung, heart, liver, spleen, and kidneys (not shown). In contrast, expression of human OASL message in small intestine was low, with greater expression in spleen, peripheral blood leukocytes, and other tissues (26). In cell lines, human OASL message was induced by IFN-alpha or IFN-gamma (26, 49). Murine OASL-1 (M1204), cloned from a murine spleen dendritic cell library, was expressed in thymus, bone marrow, and mature dendritic cells, but not in the other leukocytes tested, and was localized by in situ hybridization to dendritic cells in spleen and lung (65). Future studies directly comparing the expression and regulation of murine OASL-1 and OASL-2 may provide useful clues about their functions.

The LINCR cDNA encodes a novel protein related to the Drosophila neuralized gene product, which is involved in Notch pathway-dependent cell fate decisions (34, 35, 75). The Neur protein is localized primarily to the plasma membrane (34, 75). It contains two copies of the distinctive NR domain, plus a COOH-terminal C3HC4 RING domain (10, 47). Recent studies have shown that the RING domains of Drosophila and Xenopus Neur have ubiquitin E3 ligase activity and that at least one of the targets of ubiquitination by Neur is the Notch ligand Delta (16, 33, 44, 74). Human and murine homologs of Drosophila neur have also been identified recently. Human Neur was cloned as potential tumor suppressor gene on chromosome 10 at a site frequently deleted in malignant astrocytomas (42). Remarkably, the murine and human Neur proteins are 94% identical (52, 67), suggesting that they serve a critical, highly conserved function.

Murine LINCR and its predicted human homolog on chromosome 2 (Fig. 4) share a COOH-terminal RING domain similar to those in murine, human, and Drosophila Neur, and in C. elegans F10D7.5 but have only a single NR domain (Fig. 5). Murine Neur was expressed in multiple tissues in the embryo but was detected in adults only in brain (52), consistent with functions in development and the nervous system. In contrast, LINCR mRNA was expressed in the adult mouse small intestine, a tissue constantly exposed to inflammatory stimulation by luminal bacteria. LINCR expression was also induced in the lung during endotoxemia and attenuated by Dex (Fig. 1 and data not shown). LINCR's expression pattern and structural similarity to Neur suggest the hypothesis that it may act as an E3 ligase to target for degradation one or more components of signaling pathways involved in innate immune or cell differentiation responses.

The 36 cDNAs identified in this study probably represent only a fraction of the GARGs involved in the lung response to endotoxemia. We know that the differential screening was not exhaustive, because eleven of the 13 confirmed GARGs from the group 3 candidate pool were single isolates. Furthermore, known GARGs including IFN-gamma , IL-6, LIX, and MIG (Table 1) were not identified in the screening, perhaps because their message expression was low at the 2-h time point chosen for the differential screening. Injection of LPS is expected to trigger a cascade of immediate-early, early, and late gene induction, so we would expect to identify different sets of GARGs if the evaluation were performed at other time points. Together, our results suggest that future studies using microarrays or other techniques could identify many additional glucocorticoid-attenuated response genes whose functions and roles in lung inflammation are presently unknown.


    ACKNOWLEDGEMENTS

This work was supported by National Heart, Lung, and Blood Institute Grant HL-57008 to J. B. Smith.


    FOOTNOTES

Present addresses: Heather Hughes, Dept. of Neurobiology and Behavior, Univ. of California, Irvine, CA; Leonor Rovai, Manufacturing Research & Technology, Alpha Therapeutic Corp., Los Angeles, CA.

Address for reprint requests and other correspondence: J. B. Smith, Pediatrics/Neonatology, UCLA Center for the Health Sciences B2-325, 10833 Le Conte Ave., Los Angeles, CA 90095 (E-mail: JBSmith{at}ucla.edu).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

April 26, 2002;10.1152/ajplung.00496.2001

Received 31 December 2001; accepted in final form 11 April 2002.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

1.   Adcock, IM. Molecular mechanisms of glucocorticosteroid actions. Pulm Pharmacol Ther 13: 115-126, 2000[ISI][Medline].

2.   Altschul, SF, Madden TL, Schäffer AA, Zhang J, Zhang Z, Miller W, and Lipman DJ. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res 25: 3389-3402, 1997[Abstract/Free Full Text].

3.   American Academy of Pediatrics and Canadian Paediatric Society. Postnatal corticosteroids to treat or prevent chronic lung disease in preterm infants. Pediatrics 109: 330-338, 2002[Abstract/Free Full Text].

4.   Bancalari, E. Corticosteroids and neonatal chronic lung disease. Eur J Pediatr 157: S31-S37, 1998[Medline].

5.   Barnes, PJ. Anti-inflammatory actions of glucocorticoids: molecular mechanisms. Clin Sci (Colch) 94: 557-572, 1998[Medline].

6.   Barrington, KJ. The adverse neuro-developmental effects of postnatal steroids in the preterm infant: a systematic review of RCTs. BMC Pediatr 1: 1, 2001[Medline].

7.   Bertini, R, Bianchi M, and Ghezzi P. Adrenalectomy sensitizes mice to the lethal effects of interleukin 1 and tumor necrosis factor. J Exp Med 167: 1708-1712, 1988[Abstract/Free Full Text].

8.   Boehm, U, Guethlein L, Klamp T, Ozbek K, Schaub A, Fütterer A, Pfeffer K, and Howard JC. Two families of GTPases dominate the complex cellular response to IFN-gamma. J Immunol 161: 6715-6723, 1998[Abstract/Free Full Text].

9.   Boehm, U, Klamp T, Groot M, and Howard JC. Cellular responses to interferon-gamma. Annu Rev Immunol 15: 749-795, 1997[ISI][Medline].

10.   Boulianne, GL, de la Concha A, Campos-Ortega JA, Jan LY, and Jan YN. The Drosophila neurogenic gene neuralized encodes a novel protein and is expressed in precursors of larval and adult neurons. EMBO J 10: 2975-2983, 1991[ISI][Medline].

11.   Brower, RG, Ware LB, Berthiaume Y, and Matthay MA. Treatment of ARDS. Chest 120: 1347-1367, 2001[ISI][Medline].

12.   Burge, C, and Karlin S. Prediction of complete gene structures in human genomic DNA. J Mol Biol 268: 78-94, 1997[ISI][Medline].

13.   Chebath, J, Merlin G, Metz R, Benech P, and Revel M. Interferon-induced 56,000 Mr protein and its mRNA in human cells: molecular cloning and partial sequence of the cDNA. Nucleic Acids Res 11: 1213-1226, 1983[Abstract/Free Full Text].

14.   Clark, RH, Gerstmann DR, Jobe AH, Moffitt ST, Slutsky AS, and Yoder BA. Lung injury in neonates: causes, strategies for prevention, and long-term consequences. J Pediatr 139: 478-486, 2001[ISI][Medline].

15.   De Veer, MJ, Holko M, Frevel M, Walker E, Der S, Paranjape JM, Silverman RH, and Williams BR. Functional classification of interferon-stimulated genes identified using microarrays. J Leukoc Biol 69: 912-920, 2001[Abstract/Free Full Text].

16.   Deblandre, GA, Lai EC, and Kintner C. Xenopus neuralized is a ubiquitin ligase that interacts with XDelta1 and regulates Notch signaling. Dev Cell 1: 795-806, 2001[ISI][Medline].

17.   Diatchenko, L, Lau YF, Campbell AP, Chenchik A, Moqadam F, Huang B, Lukyanov S, Lukyanov K, Gurskaya N, Sverdlov ED, and Siebert PD. Suppression subtractive hybridization: a method for generating differentially regulated or tissue-specific cDNA probes and libraries. Proc Natl Acad Sci USA 93: 6025-6030, 1996[Abstract/Free Full Text].

18.   Diatchenko, L, Lukyanov S, Lau YF, and Siebert PD. Suppression subtractive hybridization: a versatile method for identifying differentially expressed genes. Methods Enzymol 303: 349-380, 1999[ISI][Medline].

19.   Farber, JM. Mig and IP-10: CXC chemokines that target lymphocytes. J Leukoc Biol 61: 246-257, 1997[Abstract].

20.   Finer, NN, Craft A, Vaucher YE, Clark RH, and Sola A. Postnatal steroids: short-term gain, long-term pain? J Pediatr 137: 9-13, 2000[ISI][Medline].

21.   Freemont, PS. RING for destruction? Curr Biol 10: R84-R87, 2000[ISI][Medline].

22.  Gorbacheva VY, Lindner D, Sen GC, and Vestal DJ. The IFN-induced GTPase, mGBP-2: role in IFN-gamma induced murine fibroblast proliferation. J Biol Chem (November 28, 2001). 10.1074/jbc. M110542200.

23.   Guenzi, E, Topolt K, Cornali E, Lubeseder-Martellato C, Jorg A, Matzen K, Zietz C, Kremmer E, Nappi F, Schwemmle M, Hohenadl C, Barillari G, Tschachler E, Monini P, Ensoli B, and Sturzl M. The helical domain of GBP-1 mediates the inhibition of endothelial cell proliferation by inflammatory cytokines. EMBO J 20: 5568-5577, 2001[ISI][Medline].

24.   Halonen, SK, Taylor GA, and Weiss LM. Gamma interferon-induced inhibition of Toxoplasma gondii in astrocytes is mediated by IGTP. Infect Immun 69: 5573-5576, 2001[Abstract/Free Full Text].

25.   Han, BH, Park DJ, Lim RW, Im JH, and Kim HD. Cloning, expression, and characterization of a novel guanylate-binding protein, GBP3 in murine erythroid progenitor cells. Biochim Biophys Acta 1384: 373-386, 1998[Medline].

26.   Hartmann, R, Olsen HS, Widder S, Jorgensen R, and Justesen J. p59OASL, a 2'-5' oligoadenylate synthetase like protein: a novel human gene related to the 2'-5' oligoadenylate synthetase family. Nucleic Acids Res 26: 4121-4128, 1998[Abstract/Free Full Text].

27.   Jackson, PK, Eldridge AG, Freed E, Furstenthal L, Hsu JY, Kaiser BK, and Reimann JD. The lore of the RINGs: substrate recognition and catalysis by ubiquitin ligases. Trends Cell Biol 10: 429-439, 2000[ISI][Medline].

28.   Joazeiro, CA, and Weissman AM. RING finger proteins: mediators of ubiquitin ligase activity. Cell 102: 549-552, 2000[ISI][Medline].

29.   Jobe, AH, and Bancalari E. Bronchopulmonary dysplasia. Am J Respir Crit Care Med 163: 1723-1729, 2001[Free Full Text].

30.   Justesen, J, Hartmann R, and Kjeldgaard NO. Gene structure and function of the 2'-5'-oligoadenylate synthetase family. Cell Mol Life Sci 57: 1593-1612, 2000[ISI][Medline].

31.   Karlsen, AE, Ronn SG, Lindberg K, Johannesen J, Galsgaard ED, Pociot F, Nielsen JH, Mandrup-Poulsen T, Nerup J, and Billestrup N. Suppressor of cytokine signaling 3 (SOCS-3) protects beta-cells against interleukin-1beta- and interferon-gamma-mediated toxicity. Proc Natl Acad Sci USA 98: 12191-12196, 2001[Abstract/Free Full Text].

32.   Kozak, M. Interpreting cDNA sequences: some insights from studies on translation. Mamm Genome 7: 563-574, 1996[ISI][Medline].

33.   Lai, EC, Deblandre GA, Kintner C, and Rubin GM. Drosophila neuralized is a ubiquitin ligase that promotes the internalization and degradation of delta. Dev Cell 1: 783-794, 2001[ISI][Medline].

34.   Lai, EC, and Rubin GM. Neuralized functions cell-autonomously to regulate a subset of notch-dependent processes during adult Drosophila development. Dev Biol 231: 217-233, 2001[ISI][Medline].

35.   Lai, EC, and Rubin GM. Neuralized is essential for a subset of Notch pathway-dependent cell fate decisions during Drosophila eye development. Proc Natl Acad Sci USA 98: 5637-5642, 2001[Abstract/Free Full Text].

36.   Lee, CG, Demarquoy J, Jackson MJ, and O'Brien WE. Molecular cloning and characterization of a murine LPS-inducible cDNA. J Immunol 152: 5758-5767, 1994[Abstract].

37.   Lennon, G, Auffray C, Polymeropoulos M, and Soares MB. The IMAGE Consortium: an integrated molecular analysis of genomes and their expression. Genomics 33: 151-152, 1996[ISI][Medline].

38.   Masferrer, JL, Seibert K, Zweifel B, and Needleman P. Endogenous glucocorticoids regulate an inducible cyclooxygenase enzyme. Proc Natl Acad Sci USA 89: 3917-3921, 1992[Abstract/Free Full Text].

39.   McEwen, BS, Biron CA, Brunson KW, Bulloch K, Chambers WH, Dhabhar FS, Goldfarb RH, Kitson RP, Miller AH, Spencer RL, and Weiss JM. The role of adrenocorticoids as modulators of immune function in health and disease: neural, endocrine and immune interactions. Brain Res Rev 23: 79-133, 1997[Medline].

40.   Munck, A, Guyre PM, and Holbrook NJ. Physiological functions of glucocorticoids in stress and their relation to pharmacological actions. Endocr Rev 5: 25-44, 1984[ISI][Medline].

41.   Munck, A, and Naray-Fejes-Toth A. Glucocorticoids and stress: permissive and suppressive actions. Ann NY Acad Sci 746: 115-130, 1994[ISI][Medline].

42.   Nakamura, H, Yoshida M, Tsuiki H, Ito K, Ueno M, Nakao M, Oka K, Tada M, Kochi M, Kuratsu J, Ushio Y, and Saya H. Identification of a human homolog of the Drosophila neuralized gene within the 10q25.1 malignant astrocytoma deletion region. Oncogene 16: 1009-1019, 1998[ISI][Medline].

43.   Page, RD. TreeView: an application to display phylogenetic trees on personal computers. Comput Appl Biosci 12: 357-358, 1996[Free Full Text].

44.   Pavlopoulos, E, Pitsouli C, Klueg KM, Muskavitch MA, Moschonas NK, and Delidakis C. Neuralized encodes a peripheral membrane protein involved in delta signaling and endocytosis. Dev Cell 1: 807-816, 2001[ISI][Medline].

45.   Pezeshki, G, Pohl T, and Schobitz B. Corticosterone controls interleukin-1 beta expression and sickness behavior in the rat. J Neuroendocrinol 8: 129-135, 1996[ISI][Medline].

46.   Prakash, B, Praefcke GJ, Renault L, Wittinghofer A, and Herrmann C. Structure of human guanylate-binding protein 1 representing a unique class of GTP-binding proteins. Nature 403: 567-571, 2000[Medline].

47.   Price, BD, Chang Z, Smith R, Bockheim S, and Laughon A. The Drosophila neuralized gene encodes a C3HC4 zinc finger. EMBO J 12: 2411-2418, 1993[ISI][Medline].

48.   Rebouillat, D, and Hovanessian AG. The human 2',5'-oligoadenylate synthetase family: interferon-induced proteins with unique enzymatic properties. J Interferon Cytokine Res 19: 295-308, 1999[ISI][Medline].

49.   Rebouillat, D, Marié I, and Hovanessian AG. Molecular cloning and characterization of two related and interferon-induced 56-kDa and 30-kDa proteins highly similar to 2'-5' oligoadenylate synthetase. Eur J Biochem 257: 319-330, 1998[ISI][Medline].

50.   Reichardt, HM, Umland T, Bauer A, Kretz O, and Schütz G. Mice with an increased glucocorticoid receptor gene dosage show enhanced resistance to stress and endotoxic shock. Mol Cell Biol 20: 9009-9017, 2000[Abstract/Free Full Text].

51.   Rovai, LE, Herschman HR, and Smith JB. The murine neutrophil-chemoattractant chemokines LIX, KC, and MIP-2 have distinct induction kinetics, tissue distributions, and tissue-specific sensitivities to glucocorticoid regulation in endotoxemia. J Leukoc Biol 64: 494-502, 1998[Abstract].

52.   Ruan, Y, Tecott L, Jiang MM, Jan LY, and Jan YN. Ethanol hypersensitivity and olfactory discrimination defect in mice lacking a homolog of Drosophila neuralized. Proc Natl Acad Sci USA 98: 9907-9912, 2001[Abstract/Free Full Text].

53.   Ruzek, MC, Pearce BD, Miller AH, and Biron CA. Endogenous glucocorticoids protect against cytokine-mediated lethality during viral infection. J Immunol 162: 3527-3533, 1999[Abstract/Free Full Text].

54.   Sachs, AB. Messenger RNA degradation in eukaryotes. Cell 74: 413-421, 1993[ISI][Medline].

55.   Schobitz, B, Van Den Dobbelsteen M, Holsboer F, Sutanto W, and De Kloet ER. Regulation of interleukin 6 gene expression in rat. Endocrinology 132: 1569-1576, 1993[Abstract].

56.   Sen, GC. Novel functions of interferon-induced proteins. Semin Cancer Biol 10: 93-101, 2000[ISI][Medline].

57.   Smith, JB, and Herschman HR. The glucocorticoid attenuated response genes GARG-16, GARG-39, and GARG-49/IRG2 encode inducible proteins containing multiple tetratricopeptide repeat domains. Arch Biochem Biophys 330: 290-300, 1996[ISI][Medline].

58.   Smith, JB, and Herschman HR. Glucocorticoid-attenuated response genes encode intercellular mediators, including a new C-X-C chemokine. J Biol Chem 270: 16756-16765, 1995[Abstract/Free Full Text].

59.   Smith, JB, and Herschman HR. Identification of inflammatory mediators by screening for glucocorticoid-attenuated response genes. Methods Enzymol 287: 250-265, 1997[ISI][Medline].

60.   Speer, CP. New insights into the pathogenesis of pulmonary inflammation in preterm infants. Biol Neonate 79: 205-209, 2001[ISI][Medline].

61.   Suzuki, A, Hanada T, Mitsuyama K, Yoshida T, Kamizono S, Hoshino T, Kubo M, Yamashita A, Okabe M, Takeda K, Akira S, Matsumoto S, Toyonaga A, Sata M, and Yoshimura A. CIS3/SOCS3/SSI3 plays a negative regulatory role in STAT3 activation and intestinal inflammation. J Exp Med 193: 471-481, 2001[Abstract/Free Full Text].

62.   Tatsumi, R, Hamada K, Sekiya S, Wakamatsu M, Namikawa T, Mizutani M, and Sokawa Y. 2',5'-oligoadenylate synthetase gene in chicken: gene structure, distribution of alleles and their expression. <