AJP - Lung Fuel your research with LabChart
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Lung Cell Mol Physiol 284: L84-L89, 2003. First published August 30, 2002; doi:10.1152/ajplung.00077.2002
1040-0605/03 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
284/1/L84    most recent
00077.2002v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (58)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Novak, T. E.
Right arrow Articles by Espat, N. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Novak, T. E.
Right arrow Articles by Espat, N. J.
Vol. 284, Issue 1, L84-L89, January 2003

NF-kappa B inhibition by omega -3 fatty acids modulates LPS-stimulated macrophage TNF-alpha transcription

Todd E. Novak, Tricia A. Babcock, David H. Jho, W. Scott Helton, and N. Joseph Espat

Laboratories of Surgical Metabolism, University of Illinois at Chicago, Chicago, Illinois 60612


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

omega -3 Fatty acid (FA) emulsions reduce LPS-stimulated murine macrophage TNF-alpha production, but the exact mechanism has yet to be defined. The purpose of this study was to determine the mechanism for omega -3 FA inhibition of macrophage TNF-alpha production following LPS stimulation. RAW 264.7 cells were pretreated with isocaloric emulsions of omega -3 FA (Omegaven), omega -6 FA (Lipovenos), or DMEM and subsequently exposed to LPS. Ikappa B-alpha and phospho-Ikappa B-alpha were determined by Western blotting. NF-kappa B binding was assessed using the electromobility shift assay, and activity was measured using a luciferase reporter vector. RT-PCR and ELISA quantified TNF-alpha mRNA and protein levels, respectively. Pretreatment with omega -3 FA inhibited Ikappa B phosphorylation and significantly decreased NF-kappa B activity. Moreover, omega -3-treated cells demonstrated significant decreases in both TNF-alpha mRNA and protein expression by 47 and 46%, respectively. These experiments demonstrate that a mechanism for proinflammatory cytokine inhibition in murine macrophages by omega -3 FA is mediated, in part, through inactivation of the NF-kappa B signal transduction pathway secondary to inhibition of Ikappa B phosphorylation.

eicosapentaenoic acid; nuclear factor-kappa B; signal transduction; tumor necrosis factor-alpha


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

FISH OIL EMULSIONS rich in omega -3 fatty acids (FA) have consistently demonstrated anti-inflammatory properties primarily through their effects on the macrophage (MØ) component of the inflammatory response (7, 10). However, studies examining the effects of omega -3 FA on the elaboration of proinflammatory cytokines (PIC) in MØ have been reported with variable results, a likely occurrence from the lack of a pure and consistent source of experimental omega -3 FA substrate (7, 14, 16, 21). As pharmaceutical grade omega -3 FA have not been available, their true biological effects are obfuscated from EPA oxidation, endotoxin contamination, and the inherent suppression of the macrophage inflammatory response by albumin alone (25). A commercially available pharmaceutical grade omega -3 FA emulsion Omegaven recently became available that enables the experimental evaluation of specific mechanisms of omega -3 FA action without the confounding variables of impurity. This fish oil emulsion is currently used as an anti-inflammatory agent for critically ill patients (19, 20). However, the mechanisms of action are not well defined. Moreover, a pure and isoenergetic omega -6 FA emulsion (Lipovenos) is also available for use as a true experimental control, allowing exclusion of the nonspecific effects of lipids on MØ in these experiments.

Previous studies in our laboratory have demonstrated that omega -3 FA emulsions inhibit LPS-mediated TNF-alpha expression in MØ, although the mechanisms of action are still unknown (1). It is hypothesized that omega -3 FA may modulate NF-kappa B transcriptional activator proteins, a principal pathway for MØ PIC elaboration (4, 5).

NF-kappa Bs are dimers usually located in the cytoplasm associated with an inhibitor protein (Ikappa B) (2). Under basal conditions, Ikappa B maintains NF-kappa B in the cytoplasm by preventing display of the nuclear localization sequence (3, 6). When MØs are activated by a large variety of inducers, including endotoxin via the Tlr-4 receptor (18), Ikappa B kinase-alpha phosphorylates Ikappa B at two serine residues (Ser 32 and 36) allowing dissociation from NF-kappa B (8, 23, 24). Phosphorylated Ikappa B is subsequently targeted for polyubiquitination and degradation through the 26S proteosome pathway. NF-kappa B is then free to localize to the nucleus initiating transcription of various PIC genes, most notably TNF-alpha (14).

The activation of NF-kappa B plays a vital role in the elaboration of TNF-alpha ; therefore, we hypothesized that omega -3 FA may exert inhibitory effects at a specific point along the NF-kappa B pathway. The purpose of these experiments was to define a mechanism for omega -3 FA inhibition of MØ TNF-alpha production following LPS stimulation.


    MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Materials. Escherichia coli 0111:B4 LPS was purchased from Sigma (St. Louis, MO). The murine MØ cell line RAW 264.7 was obtained from American Type Culture Collection (Rockville, MD). Omegaven (omega -3 FA emulsion) and Lipovenos (omega -6 FA emulsion) were purchased from Fresenius-Kabi (Bad-Homburg, Germany).

Cell culture. RAW 264.7 cells were suspended in complete medium, DMEM (Mediatech, Herndon, VA) (supplemented with 10% FBS, 100 U/ml penicillin, and 100 U/ml streptomycin). In all experiments, cells were plated in 24-well plates (except transfections, 35-mm plates; nuclear extraction, 100-mm plates) at a density of 1 × 106 cells/well. All experiments were performed in a humidified atmosphere under 5% CO2 at 37°C.

Experimental design. All experiments adhered to the following protocol unless otherwise noted. Cells were randomly separated into three separate treatment groups: media alone (DMEM), omega -3 FA emulsion, or omega -6 FA emulsion. Cells were allowed to adhere for 2 h and then incubated in the presence of Omegaven (12 mg%, omega -3 FA emulsion), Lipovenos (10 mg%, isoenergetic, isocaloric omega -6 FA emulsion), or DMEM for 4 h. Optimal concentrations for MØ TNF-alpha inhibition were determined in previous studies (1). The cells were washed twice with DMEM and then stimulated with LPS (1 µg/ml) for 3 h. After LPS incubation, the cells were washed twice with DMEM and then examined as described below.

Measurement of Ikappa B phosphorylation. To investigate the effects of omega -3 FA on Ikappa B phosphorylation, total cellular protein from omega -3-treated RAW cells was analyzed via Western blotting. Cells were lysed with ×1 lysis buffer, 75 µg Ikappa B, and 150 µg (phosphor-Ikappa B) of total protein were separately loaded on 10% SDS-PAGE gels (Bio-Rad, Hercules, CA), along with 0.35 µg of biotinylated protein standard (New England Biolabs, Beverly, MA), and run at 100 V for 70 min. The gel was transblotted to a nitrocellulose membrane (Bio-rad) at 300 mA for 70 min. The membrane was blocked with 5% nonfat dry milk in TBS containing 1% Tween 20 (TBST) for 90 min and then incubated in the presence of the primary antibody specific for Ikappa B or phospho-Ikappa B (New England Biolabs) (1:1,000 dilution, TBST with 5% BSA) overnight at 4°C. The membrane was then washed three times for 10 min each in TBST and subsequently exposed to an anti-biotin antibody (1:1,000 dilution) and anti-rabbit-HRP antibody (1:2,000 dilution) (New England Biolabs) for 1 h. The membrane was then washed again three times with TBST. The protein was detected by incubating the membrane with TMB Stabilized Substrate for HRP (Promega, Madison, WI) for 5 min.

Nuclear protein extraction and EMSA. Cells were grown to confluence (1 × 107 cells) in 100-mm plates and treated as described in Experimental design. After endotoxin exposure, cells were washed twice with ice-cold PBS, and total nuclear extract was prepared using the reagents and protocol described by Active Motif LLC (Carlsbad, CA). For the EMSA, T4 polynucleotide kinase, poly(dI-dC), [32P]ATP, and the Sephadex G-50M column were purchased from Amersham Biosciences (Piscataway, NJ). All other reagents for this experiment were obtained from Sigma Chemical unless otherwise specified. The probe was a 24-bp double-stranded construct of the NF-kappa B consensus sequence (5'-AGGGACTTTCCGCTG GGACTTTCC-3'), which was end-labeled using T4 polynucleotide kinase and [32P]ATP. The labeled probe was purified on a Sephadex G-50M column. For each sample, 5 µg of total nuclear protein were incubated with the labeled double-stranded probe (~50,000 cpm) and 5 µg of poly(dI-dC) in binding buffer (10 mM Tris · HCl, pH 7.5, 100 mM NaCl, 1 mM EDTA, 0.2% Nonidet P-40, and 0.5 mM dithiothreitol) for 20 min at 25°C. Specific competition was done by adding 100 ng of unlabeled NF-kappa B double-stranded binding probe to the reaction. The mixtures were run on 5% polyacrylamide gel electrophoresis in ×1 Tris-glycine-EDTA buffer. The gels were then vacuum-dried and exposed to radiographic film (Eastman Kodak, New Haven, CT).

Transfection of luciferase reporter vector. When measuring NF-kappa B activity, RAW cells were first transfected, before FA exposure, with a luciferase reporter vector (Clontech, Palo Alto, CA) containing four tandem copies of the NF-kappa B consensus sequence fused to a TATA-like region from the Herpes simplex virus thymidine kinase (HSV-TK) promoter. All transfection media (exclusive of FBS) were supplemented with 1.0 µg/ml protamine sulfate. Protamine has been shown to increase lipid-mediated transfection of MØ by condensing DNA structure into a compact structure (9). In addition, the nuclear localization amino acid signal of protamine increases the nuclear translocation of DNA, thus enhancing luciferase transcription (11). One microgram of NF-kappa B luciferase vector was transfected with 8 µl of lipid in 200 µl of DMEM via the LipofectAMINE method (Invitrogen, Carlsbad, CA) for 5 h into RAW 264.7 cells. Zero point one microgram Renilla luciferase-positive control vector (pRL-SV40: Promega) was cotransfected with the NF-kappa B luciferase vector to normalize the transfection efficiency. pTAL-Luc (Clontech), substituting for the NF-kappa B luciferase vector, was used as a negative control. After the 5-h incubation, 1 ml DMEM with ×2 FBS was overlaid onto the cells. Transfection medium was replaced with complete medium at 18 h from start of the transfection.

Measurement of NF-kappa B activity. Transfected RAW cells were treated as described in Experimental design and then lysed with 150 µl ×1 passive lysis buffer (Promega) for 15 min at room temperature. Firefly and Renilla luciferase activities were obtained by analyzing 10 µl of protein lysate following the protocol provided by the Dual Luciferase Reporter Assay System (Promega) in a TD-20/20 luminometer (Turner Designs, Sunnyvale, CA) (2-s delay, 10-s count). To adjust for any variation in transfection efficiency, the results were reported as firefly luciferase activity divided by Renilla luciferase activity.

RT-PCR analysis of TNF-alpha message. Total RNA from 4 × 106 treated RAW cells was extracted with 1 ml TRI reagent (Molecular Research Center, Cincinnati, OH). The samples were spun at 16,000 g for 10 min at 4°C, and then 700 µl of supernatant were removed and added to 70 µl 1-bromo-3-chloro-propane (Sigma). Samples were vortexed, incubated at room temperature for 10 min, and then spun for 5 min at 4°C. Three-hundred-fifty microliters of the resulting supernatant were added to an equal volume of Phenol/Isoamyl Alcohol/Chloroform (Fischer Scientific, Pittsburgh, PA), vortexed, and spun for 10 min at 4°C. Three-hundred microliters of the resulting supernatant were added to an equal volume of ice-cold isopropanol (Fischer) and precipitated at -20°C overnight. Samples were then spun at 16,000 g for 15 min at 4°C, washed with 75% ethanol, and the final RNA precipitant was suspended in 10 µl DEPC-treated water. RNA concentrations were determined spectrophotometrically at 260 nm, while the A260/A280 ratio measured the purity of the samples. The first strand cDNA synthesis containing 0.8 µg total RNA was primed with oligo(dT) and 1 cycle was run: 15 min at 42°C, 5 min at 99°C, and 10 min at 5°C. Specific primers (Invitrogen) were used for TNF-alpha (sense, TCTCATCAGTTCTATGGCCC; antisense, GGGAGTAGACAAGGTACAAC) and GAPDH (sense, AGCCTTCTCCATGGTGGTGAAGAC; antisense, CGGAGTCAACGGATTTGGTCGTAT). The PCR cycling conditions for all reactions were as follows: 94°C for 1 min, 60°C for 35 s, and a final extension period at 72°C for 7 min. Optimal amplification was achieved at 26 cycles for TNF-alpha and GAPDH. GAPDH served as an internal control. The PCR products were run alongside 0.25 µg of 100-bp molecular standard ladder (Bio-rad) on a 1.5% agarose gel containing ethidium bromide. After separation, the bands were visualized under UV light (Fischer Scientific) and analyzed with 1D software (Eastman Kodak). The results were expressed as the relative intensity vs. the control (GADPH).

ELISA for TNF-alpha . Supernatants from treated RAW 264.7 cells were collected and immediately frozen at -70°C. The samples were subsequently analyzed for TNF-alpha protein following the protocol provided by R&D Systems (Minneapolis, MN).

Statistical analysis. TNF-alpha and NF-kappa B data are presented as means ± SE. The data were analyzed by one-way ANOVA, as well as additional ANOVA post hoc analysis (Tukey and Scheffé's). Statistical significance was defined at the P < 0.05 level.


    RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Effects of omega -3 FA on Ikappa B phosphorylation. The amount of total Ikappa B, phosphorylated and unphosphorylated, did not deviate from baseline levels (DMEM + LPS) after 3-h LPS exposure (Fig. 1A). The amount of phospho-Ikappa B, however, did change significantly depending on the treatment (Fig. 1, B and C). A small amount of Ikappa B phosphorylation is evident in nonstimulated MØ for all three treatments. DMEM and omega -6 FA pretreatment, followed by LPS stimulation, exhibited approximately the same moderate increase in phospho-Ikappa B. Conversely, omega -3 FA treatment significantly decreased the amount of Ikappa B phosphorylation; the intensity is similar to the nonstimulated cells.


View larger version (37K):
[in this window]
[in a new window]
 
Fig. 1.   Representative Western blot analysis of Ikappa B-alpha (A) and phospho-Ikappa B-alpha (B) protein. RAW cells were pretreated with DMEM, omega -3 fatty acids (FA), or omega -6 FA for 4 h, washed, and then exposed to DMEM (-) or endotoxin (+) for 3 h. The cells were subsequently washed and then lysed to obtain cellular protein. Seventy-five grams and 150 g total protein were separately loaded in each lane for Ikappa B (A) and phospho-Ikappa B (B), respectively. Blots represent 1 of 3 experiments with similar results. C: semiquantification of the phospho-Ikappa B blot. The band intensities were quantified using Kodak 1D. DMEM + LPS was set at 100, and background was set at 0.

Effects of omega -3 FA on NF-kappa B binding and activity. A low basal level of NF-kappa B binding to the TNF-alpha -specific consensus sequence was observed in non-LPS-stimulated MØ, whereas LPS exposure generated strong binding of NF-kappa B in both DMEM- and omega -6-pretreated cells but not after omega -3 FA (Fig. 2). Moreover, the effects of DMEM, omega -3, and omega -6 FAs on NF-kappa B binding parallel the results seen in the activity studies (Fig. 3). A low level of NF-kappa B activity was observed in non-LPS-stimulated MØ. Strong activation of NF-kappa B was induced after LPS exposure, as shown by the large increase in luciferase activity in both the DMEM- and omega -6-pretreated cells. Conversely, omega -3 pretreatment significantly decreased NF-kappa B activation by 63% under control levels following endotoxin exposure (P < 0.01). It should be noted that transfecting with protamine sulfate in the media did not alter basal luciferase activity and that the pTAL vector (control) produced nominal luciferase activity (data not shown).


View larger version (64K):
[in this window]
[in a new window]
 
Fig. 2.   NF-kappa B binding activity via EMSA. Confluent cells were pretreated with DMEM, omega -3 FA emulsion, or omega -6 FA emulsion for 4 h, washed, and then exposed to DMEM (-) or LPS (+) for 3 h. Total nuclear protein was subsequently isolated and analyzed by EMSA for NF-kappa B DNA binding activity using a 32P-labeled double-stranded oligonucleotide of the NF-kappa B consensus sequence 5'-AGGGACTTTCCGCTGGGACTTTCC-3'. An additional nonlabeled probe was added in the competition assay (cold).



View larger version (16K):
[in this window]
[in a new window]
 
Fig. 3.   Luciferase activity of NF-kappa B reporter vector in RAW cells. One gram of firefly reporter plasmid was transfected, along with 0.01 g of SV40 Renilla luciferase reporter as a transfection efficiency control, into 1 × 106 RAW cells for 5 h. The cells were subsequently treated with DMEM, omega -3 FA, or omega -6 FA for 4 h, washed, and then incubated in the presence of DMEM (-) or LPS (+) (1 g/ml) for 3 h. The cells were then lysed and firefly and Renilla luciferase activities were determined. Intensity values are reported as firefly/Renilla (n = 3). Data represent means ± SE. * Mean difference is significant at the 0.05 level.

omega -3 FA effects on TNF-alpha message transcription. MØ incubated in the presence of DMEM, omega -3 FA, and omega -6 FA demonstrated similar low levels of constitutive expression of TNF-alpha mRNA (Fig. 4). After LPS stimulation, cells pretreated with DMEM and omega -6 FA averaged greater than a 100% increase in transcription over basal levels. Conversely, LPS-stimulated cells first exposed to omega -3 FA demonstrated a significant decrease (47%) in TNF-alpha mRNA levels under the control; this value is only a 15% increase over the control media (DMEM) without LPS. This difference is statistically significant with a P value of <0.01.


View larger version (31K):
[in this window]
[in a new window]
 
Fig. 4.   Effects of omega -FA on RAW cell TNF-alpha mRNA expression. RAW cells were pretreated with DMEM, omega -3 FA emulsion, or omega -6 FA emulsion for 4 h, washed, and then exposed to DMEM (-) or endotoxin (+) for 3 h. Total RNA was extracted and TNF-alpha message determined via RT-PCR (A). The band intensities were quantified using Kodak 1D software and are illustrated in the bar graph (B). The results are expressed as the relative intensity of TNF-alpha vs. control (GAPDH) (n = 3). Data represent means ± SE. * Mean difference is significant at the 0.05 level.

omega -3 FA effects on TNF-alpha protein production. Cells pretreated with either omega -3 FA or omega -6 FA without LPS stimulation did not demonstrate a significant change in TNF-alpha production from baseline (DMEM). After LPS stimulation, TNF-alpha production from DMEM- and omega -6 FA-treated cells increased similarly. However, omega -3-treated cells displayed a significant decrease in TNF-alpha production after LPS stimulation, with a 46% decrease from baseline (P < 0.01) (Fig. 5). In addition, it should be noted that the decrease in TNF-alpha protein is congruent with the decrease in TNF-alpha message after omega -3 FA treatment, 46 and 47%, respectively.


View larger version (12K):
[in this window]
[in a new window]
 
Fig. 5.   Effects of omega -FA on RAW cell TNF-alpha production. Cells were pretreated with DMEM, omega -3 FA emulsion, or omega -6 FA emulsion for 4 h, washed, and then incubated in the presence of DMEM (-) or LPS (+) (1 g/ml) for 3 h. Supernatants were collected and analyzed by ELISA (n = 3). Data represent means ± SE. * Mean difference is significant at the 0.05 level.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

The early inflammatory response is regulated predominately by the MØ component of the immune system and is characterized by an increased production of PIC, mediated, in part, through NF-kappa B activation (4). omega -3 FA have long been considered as an anti-inflammatory agent. However, past studies have reported variable PIC elaboration. Previously available omega -3 FA sources for experimental evaluation were potentially contaminated or consisted of compound substances likely contributing to the observed experimental discrepancies. For instance, Sato et al. (21) reported that omega -3 FA treatment of human monocytes increased TNF-alpha production after LPS stimulation, yet Billiar et al. (7) demonstrated a decrease in TNF-alpha . The recent availability of a pharmaceutical grade omega -3 FA source will now allow for assessment of the cellular mechanisms that define the anti-inflammatory properties of omega -3 FA. This study investigated the effects of omega -3 FA on the elaboration of TNF-alpha in the context of a LPS-stimulated in vitro murine MØ model.

This report examined the effects of omega -3 FA on the phosphorylation of Ikappa B at serine 32 as a requirement for both NF-kappa B translocation to the nucleus and activation. The results demonstrate that following LPS stimulation, omega -3 FA pretreatment significantly decreases phosphorylation at serine 32, thus providing a basis for the observed decrease in NF-kappa B binding and activity following omega -3 incubation. Without the requisite Ikappa B phosphorylation, NF-kappa B remains inactive in the cytoplasm bound to Ikappa B. Our data indicate that total levels of Ikappa B (phosphorylated and unphosphorylated) do not deviate after a 3-h LPS treatment. These results are consistent with previous reports on the time course for Ikappa B degradation through the ubiquitin-proteosome pathway. Shanley et al. (22) reported that Ikappa B is degraded rapidly after 5 min of LPS exposure but returns to baseline levels within 30 min.

Subsequent experiments examining the effects of omega -3 FA on the NF-kappa B signal transduction cascade were initiated based on two observations: 1) omega -3 FA decrease transcription of TNF-alpha suggesting modulation of an intercellular signal transduction pathway and 2) NF-kappa B is an essential transcriptional regulator of inflammatory gene activation, including TNF-alpha . The experimental data support that omega -3 FA significantly decrease both NF-kappa B binding to the TNF-alpha -specific consensus sequence and subsequent activity in response to LPS stimulation compared with both DMEM and omega -6 FA. Moreover, MØ incubated in omega -3 FA-rich media before LPS stimulation produces significantly less TNF-alpha message elaboration. These data implicate that a major anti-inflammatory mechanism for omega -3 FA is reduction of TNF-alpha gene transcription, mediated, in part, through inhibition of NF-kappa B regulatory proteins. As TNF-alpha protein decreases a proportional amount, the anti-inflammatory effects of omega -3 FA on TNF-alpha occur primarily at the level of gene transcription. These results are consistent with previous studies examining the effects of omega -3 FA on TNF-alpha production in an in vitro murine MØ model (14).

The mechanisms modulating cellular events proximal to Ikappa B phosphorylation in the elaboration of TNF-alpha are still yet to be elucidated. Some studies have suggested that the incorporation of omega -3 FA into the plasma membrane alters the composition of the phospholipid pool, thus modifying the production of inflammatory lipid mediators (e.g., PGE2) (15, 17). It is thought that omega -3 FA displace arachidonic acid from plasma membranes decreasing its availability as a precursor of inflammation-associated prostanoids. Moreover, Kunkel et al. (13) reported a clear autoregulatory relationship between TNF-alpha and proinflammatory prostanglandins, particularly PGE2. Recent studies also suggest that omega -3 FA may act at the level of membrane-bound receptors. Jordan and Stein (12) propose that omega -3 FA may alter the physical and chemical properties of the plasma membrane so that receptor ligand binding is altered. On the basis of these observations, it is possible that omega -3 FA change the sensitivity of the Tlr-4 receptor for LPS, consequently inhibiting transduction of proinflammatory signals into the interior of the MØ. Future experiments are warranted in the investigation of the proximal regulatory mechanisms of omega -3 FA on Ikappa B kinase-alpha inhibition, specifically the interaction between omega -3 FA, inflammatory prostaglandin elaboration, and Tlr-4 receptor function.

In summary, the data demonstrate that treatment of murine MØ with omega -3 FA significantly decreases Ikappa B phosphorylation at serine 32 and consequently reduces the ability of NF-kappa B to bind to the TNF-alpha -specific consensus sequence. As a result, the NF-kappa B signal transduction cascade is inhibited, and this decreased NF-kappa B activity is translated into a concomitant decrease in TNF-alpha mRNA transcription. TNF-alpha protein elaboration is reduced accordingly. Moreover, the omega -6 FA-treated MØ exhibits similar effects as media alone (DMEM) in all experiments, validating that the observed anti-inflammatory effects on the MØ are exclusive to omega -3 FA and not a result of a general lipid effect. These experiments demonstrate that a mechanism for proinflammatory cytokine transcription inhibition in murine MØ by omega -3 FA is mediated, in part, through inactivation of the NF-kappa B signal transduction pathway secondary to inhibition of Ikappa B phosphorylation at serine 32.


    ACKNOWLEDGEMENTS

We are profoundly grateful for the expert assistance of Dr. K. Anwar.


    FOOTNOTES

This work was supported by the Warren and Clara Cole Foundation. T. Novak was supported in part by the Alpha Omega Alpha Student Research Fellowship.

Address for reprint requests and other correspondence: N. Joseph Espat, Dept. of Surgery M/C 958, Univ. of Illinois at Chicago, 840 South Wood St., Rm. 435E, Chicago, IL 60612 (E-mail: jespat{at}uic.edu).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

August 30, 2002;10.1152/ajplung.00077.2002

Received 13 March 2002; accepted in final form 28 August 2002.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

1.   Babcock, TA, Helton WS, Hong D, and Espat NJ. omega -3 Fatty acid lipid emulsion reduces LPS-stimulated macrophage TNF-alpha production. Surg Inf 3: 145-149, 2002.

2.   Baeuerle, PA, and Baltimore D. Activation of DNA-binding activity in an apparently cytoplasmic precursor of the NF-kappa B transcription factor. Cell 53: 211-217, 1988[ISI][Medline].

3.   Baeuerle, PA, and Baltimore D. Ikappa B: a specific inhibitor of the NF-kappa B transcription factor. Science 242: 540-546, 1988[Abstract/Free Full Text].

4.   Baeuerle, PA, and Baltimore D. NF-kappa B: ten years after. Cell 87: 13-20, 1996[ISI][Medline].

5.   Baldwin, AS. The NFkappa B and Ikappa B proteins: new discoveries and insights. Annu Rev Immunol 14: 649-683, 1996[ISI][Medline].

6.   Beg, AA, and Baldwin AS, Jr. The Ikappa B proteins: multifunctional regulators of Rel/NF-kappa B transcription factors. Genes Dev 7: 2064-2070, 1993[Free Full Text].

7.   Billiar, TR, Bankey PE, Svingen BA, Curran RD, West MA, Holman RT, Simmons RL, and Cerra FB. Fatty acid intake and Kupffer cell function: fish oil alters eicosanoid and monokine production to endotoxin stimulation. Surgery 104: 343-349, 1988[ISI][Medline].

8.   Chen, ZJ, Parent L, and Maniatis T. Site-specific phosphorylation of Ikappa Balpha by a novel ubiquitination-dependent protein kinase activity. Cell 84: 853-862, 1996[ISI][Medline].

9.   Dokka, S, Toledo D, Shi X, Ye J, and Rojanasakul Y. High-efficiency gene transfection of macrophages by lipoplexes. Int J Pharm 206: 97-104, 2000[ISI][Medline].

10.   Endres, S, Ghorbani R, Kelley VE, Georgilis K, Lonnemann G, Van der Meer JW, Cannon JG, Rogers TS, Klempner MS, and Weber PC. The effect of dietary supplementation with n-3 polyunsaturated fatty acids on the synthesis of interleukin-1 and tumor necrosis factor by mononuclear cells. N Engl J Med 320: 265-271, 1989[Abstract].

11.   Gao, X, and Huang L. Protamine sulfate enhances lipid-mediated gene transfer. Gene Ther 4: 961-968, 1997[ISI][Medline].

12.   Jordan, A, and Stein J. Modulation of epidermal growth factor-induced cell proliferation by an omega -3 fatty-acid-containing lipid emulsion on human pancreatic cancer cell line Mia Paca-2. Nutrition 17: 474-475, 2001[ISI][Medline].

13.   Kunkel, SL, Wiggins RC, Chensue SW, and Larrick J. Regulation of macrophage tumor necrosis factor production by prostaglandin E2. Biochem Biophys Res Commun 137: 404-410, 1986[ISI][Medline].

14.   Lo, C, Chiu KC, Fu M, Lo R, and Helton S. Fish oil decreases macrophage tumor necrosis factor gene transcription by altering NFkappa B activity. J Surg Res 82: 216-221, 1999[ISI][Medline].

15.   Lokesh, BR, and Kinsella JE. Modulation of prostaglandin synthesis in mouse peritoneal macrophages by enrichment of lipids with either eicosapentaenoic or docosahexaenoic acids in vitro. Immunobiology 175: 406-419, 1987[ISI][Medline].

16.   Lokesh, BR, Sayer TJ, and Kinsella JE. Interleukin-1 and tumor necrosis factor synthesis by mouse peritoneal macrophages is enhanced by dietary n-3 polyunsaturated fatty acids. Immunol Lett 23: 281-285, 1990[ISI][Medline].

17.   Magrum, LJ, and Johnston PV. Modulation of prostaglandin synthesis in rat peritoneal macrophages with omega -3 fatty acids. Lipids 18: 514-521, 1983[ISI][Medline].

18.   Medzhitov, R, and Janeway C. Innate immunity. N Engl J Med 343: 338-344, 2000[Free Full Text].

19.   Morlion, BJ, Torwesten E, Lessire H, Sturm G, Peskar BM, Furst P, and Puchstein C. The effect of parenteral fish oil on leukocyte membrane fatty acid composition and leukotriene-synthesizing capacity in patients with postoperative trauma. Metabolism 45: 1208-1213, 1996[ISI][Medline].

20.   Roulet, M, Frascarolo P, Pilet M, and Chapuis G. Effects of intravenously infused fish oil on platelet fatty acid phospholipid composition and on platelet function in postoperative trauma. JPEN 21: 296-301, 1997[Abstract].

21.   Sato, TT, Garcia IA, and Maier RV. Immunomodulation of cultured human monocytes by omega -3 fatty acid. Surg Forum 43: 9-10, 1992.

22.   Shanley, TP, Ryan MA, Eaves-Pyles T, and Wong HR. Heat shock inhibits phosphorylation of I-kappa Balpha . Shock 14: 447-450, 2000[ISI][Medline].

23.   Traenckner, EB, Pahl HL, Henkel T, Schmidt KN, Wilk S, and Baeuerle PA. Phosphorylation of human Ikappa B-alpha on serines 32 and 36 controls Ikappa B-alpha proteolysis and NF-kappa B activation in response to diverse stimuli. EMBO J 14: 2876-2883, 1995[ISI][Medline].

24.   Zandi, E, Rothwarf DM, Delhase M, Hayakawa M, and Karin M. The Ikappa B kinase complex (IKK) contains two kinase subunits, IKKalpha and IKKbeta , necessary for Ikappa B phosphorylation and NF-kappa B activation. Cell 91: 243-252, 1997[ISI][Medline].

25.   Zheng, ZM, Specter SC, and Lancz G. Bovine serum albumin preparations enhance in vitro production of tumor necrosis factor alpha  by murine macrophages. Immunol Invest 24: 737-756, 1995[ISI][Medline].


Am J Physiol Lung Cell Mol Physiol 284(1):L84-L89
1040-0605/03 $5.00 Copyright © 2003 the American Physiological Society



This article has been cited by other articles:


Home page
Am. J. Physiol. Renal Physiol.Home page
M. M. Diaz Encarnacion, G. M. Warner, C. E. Gray, J. Cheng, H. K. H. Keryakos, K. A. Nath, and J. P. Grande
Signaling pathways modulated by fish oil in salt-sensitive hypertension
Am J Physiol Renal Physiol, June 1, 2008; 294(6): F1323 - F1335.
[Abstract] [Full Text] [PDF]


Home page
Nutr Clin PractHome page
K. Gura, R. Strijbosch, S. Arnold, C. McPherson, and M. Puder
The Role of an Intravenous Fat Emulsion Composed of Fish Oil in a Parenteral Nutrition-Dependent Patient With Hypertriglyceridemia
Nutr Clin Pract, December 1, 2007; 22(6): 664 - 672.
[Abstract] [Full Text] [PDF]


Home page
Ann. Surg. Oncol.Home page
J. Hering, S. Garrean, T. R. Dekoj, A. Razzak, A. Saied, J. Trevino, T. A. Babcock, and N. J. Espat
Inhibition of Proliferation by Omega-3 Fatty Acids in Chemoresistant Pancreatic Cancer Cells
Ann. Surg. Oncol., December 1, 2007; 14(12): 3620 - 3628.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Clin. Nutr.Home page
B. Fontaine-Bisson, T. M. Wolever, J.-L. Chiasson, R. Rabasa-Lhoret, P. Maheux, R. G Josse, L. A Leiter, N W. Rodger, E. A Ryan, P. W Connelly, et al.
Genetic polymorphisms of tumor necrosis factor-{alpha} modify the association between dietary polyunsaturated fatty acids and fasting HDL-cholesterol and apo A-I concentrations
Am. J. Clinical Nutrition, September 1, 2007; 86(3): 768 - 774.
[Abstract] [Full Text] [PDF]


Home page
JPEN J Parenter Enteral NutrHome page
S. Sharif, M. Broman, T. Babcock, E. Ong, D. Jho, M. Rudnicki, W. S. Helton, and N. J. Espat
A Priori Dietary {Omega}-3 Lipid Supplementation Results in Local Pancreatic Macrophage and Pulmonary Inflammatory Response Attenuation in a Model of Experimental Acute Edematous Pancreatitis (AEP)
JPEN J Parenter Enteral Nutr, July 1, 2006; 30(4): 271 - 276.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Clin. Nutr.Home page
R. J Deckelbaum, T. S Worgall, and T. Seo
n-3 Fatty acids and gene expression
Am. J. Clinical Nutrition, June 1, 2006; 83(6): S1520 - 1525S.
[Abstract] [Full Text] [PDF]


Home page
Nutr Clin PractHome page
R. Siddiqui, D. Pandya, K. Harvey, and G. P. Zaloga
Nutrition Modulation of Cachexia/Proteolysis
Nutr Clin Pract, April 1, 2006; 21(2): 155 - 167.
[Abstract] [Full Text] [PDF]


Home page
J. Lipid Res.Home page
G. Li, D. Barnes, D. Butz, D. Bjorling, and M. E. Cook
10t,12c-conjugated linoleic acid inhibits lipopolysaccharide-induced cyclooxygenase expression in vitro and in vivo
J. Lipid Res., October 1, 2005; 46(10): 2134 - 2142.
[Abstract] [Full Text] [PDF]


Home page
Nutr Clin PractHome page
T. A. Babcock, T. Dekoj, and N. J. Espat
Experimental Studies Defining {omega}-3 Fatty Acid Antiinflammatory Mechanisms and Abrogation of Tumor-Related Syndromes
Nutr Clin Pract, February 1, 2005; 20(1): 62 - 74.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. A. Rouzer, P. J. Kingsley, H. Wang, H. Zhang, J. D. Morrow, S. K. Dey, and L. J. Marnett
Cyclooxygenase-1-dependent Prostaglandin Synthesis Modulates Tumor Necrosis Factor-{alpha} Secretion in Lipopolysaccharide-challenged Murine Resident Peritoneal Macrophages
J. Biol. Chem., August 13, 2004; 279(33): 34256 - 34268.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Clin. Nutr.Home page
M. F Leitzmann, M. J Stampfer, D. S Michaud, K. Augustsson, G. C Colditz, W. C Willett, and E. L Giovannucci
Dietary intake of n-3 and n-6 fatty acids and the risk of prostate cancer
Am. J. Clinical Nutrition, July 1, 2004; 80(1): 204 - 216.
[Abstract] [Full Text] [PDF]


Home page
Integr Cancer TherHome page
D. H. Jho, S. M. Cole, E. M. Lee, and N. J. Espat
Role of Omega-3 Fatty Acid Supplementation in Inflammation and Malignancy
Integr Cancer Ther, June 1, 2004; 3(2): 98 - 111.
[Abstract] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
Z. Ma, J. Li, L. Yang, Y. Mu, W. Xie, B. Pitt, and S. Li
Inhibition of LPS- and CpG DNA-induced TNF-{alpha} response by oxidized phospholipids
Am J Physiol Lung Cell Mol Physiol, April 1, 2004; 286(4): L808 - L816.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
T. Pischon, S. E. Hankinson, G. S. Hotamisligil, N. Rifai, W. C. Willett, and E. B. Rimm
Habitual Dietary Intake of n-3 and n-6 Fatty Acids in Relation to Inflammatory Markers Among US Men and Women
Circulation, July 15, 2003; 108(2): 155 - 160.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
284/1/L84    most recent
00077.2002v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (58)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Novak, T. E.
Right arrow Articles by Espat, N. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Novak, T. E.
Right arrow Articles by Espat, N. J.