|
|
||||||||
-actin organization in thrombin-induced human lung myofibroblasts
1Division of Rheumatology and Immunology, Department of Medicine, and 3Department of Pathology, Medical University of South Carolina, Charleston, South Carolina 29425; and 2Department of Medicine, University of Pennsylvania Medical School, Philadelphia, Pennsylvania 19104
Submitted 6 December 2002 ; accepted in final form 24 March 2003
| ABSTRACT |
|---|
|
|
|---|
-actin organization and collagen gel contraction. Our results show that
the small G protein Rho is involved in lung myofibroblast differentiation.
Thrombin induces Rho-35S-labeled guanosine
5'-O-(3-thiotriphosphate) binding in a dose-dependent manner.
It potently stimulates Rho activity in vivo and initiates protein kinase C
(PKC)-
-Rho complex formation. Toxin B, which inactivates Rho by ADP
ribosylation, inhibits thrombin-induced SM
-actin organization,
collagen gel contraction, and PKC-
-SM
-actin and PKC-
-RhoA
coimmunoprecipitation. However, it has no effect on PKC-
activation or
translocation of PKC-
to the membrane. Overexpression of constitutively
active PKC-
and constitutively active RhoA induces collagen gel
contraction or SM
-actin organization, whereas, individually, they do
not perform these functions. We therefore conclude that the contractile
activity of myofibroblasts induced by thrombin is mediated via PKC-
- and
RhoA-dependent pathways and that activation of both of these molecules is
required. We postulate that PKC-
-RhoA complex formation is an early
event in thrombin activation of lung fibroblasts, followed by PKC-
-SM
-actin coimmunoprecipitation, which leads to the PKC-
-RhoA-SM
-actin ternary complex formation.
fibroblast differentiation; protein kinase C-
; RhoA
-actin) and promote contractility of lung parenchyma associated
with restrictive lung disease
(28,
29,
43,
45).
Resting, nonactivated fibroblasts contain only
- and
-actin
isoforms (4,
10,
13). Once fibroblasts become
active, they express SM
-actin
(28,
29,
43,
45). All actin isoforms are
present in cells in a monomeric state (G-actin) or a polymeric state
(filamentous or F-actin). Filamentous actin is generally organized into three
discrete structures: actin stress fibers, lamellipodia, and filopodia. In
activated fibroblasts, SM
-actin is incorporated mainly into stress
fibers (8,
10).
Cellular functions that depend on the actin cytoskeleton require actin
organization (4,
13,
38). The dynamics of actin
organization are regulated by the complex of intracellular signaling, which
involves activation of various signal transduction molecules, including
numerous actin-binding proteins and Rho proteins
(4,
11,
16,
24). In resting cells, Rho is
present in a GTP-bound (inactive) state. Activation of Rho requires the
exchange of GDP for GTP through the action of guanine nucleotide exchange
factors. GTP-bound Rho is then targeted to the cell membrane and interacts
with its specific targets. Because of intrinsic GTPase activity, the GTP-bound
form is converted back to the GDP-bound state so that it can receive a new
activating signal (reviewed in Ref.
42). The mammalian Rho family
consists of
14 distinct members divided into subfamilies of Rho, Rac, and
Cdc42 proteins (40,
42). Rho proteins regulate
stress fiber formation (34),
whereas Rac and Cdc42 mediate signals to form lamellipodia and filopodia,
respectively (15,
35).
Previously, we reported that thrombin induces SM
-actin expression
and organization in human lung fibroblasts via a protein kinase C
(PKC)-
-dependent pathway
(2). In this study, we showed
that RhoA inactivation prevents thrombin-induced SM
-actin organization
and collagen gel contraction. Coexpression of constitutively active RhoA and
PKC-
promoted SM
-actin expression/organization and collagen gel
contraction. Separate overexpression of the constitutively active PKC-
or constitutively active RhoA was not sufficient to induce SM
-actin
organization or contractile activity in lung fibroblasts. Furthermore, we
found that thrombin induces PKC-
-RhoA-SM
-actin complex
formation. This signaling mechanism is necessary for differentiation of lung
fibroblasts to a myofibroblast phenotype by thrombin.
| METHODS |
|---|
|
|
|---|
translocation inhibitor peptide (TIP), and scrambled peptide for
TIP [TIP negative (TIPN)] were obtained from Calbiochem (La Jolla, CA), type I
collagen from BD Bioscience (Bedford, MA), and pertussis toxin and
Clostridium difficille toxin B from Sigma (St. Louis, MO). Antisense
(5'-ATTGAACACTACCAT-3') and sense
(5'-ATGGTAGTGTTCCAAT-3') oligonucleotides for PKC-
were
synthesized in the Oligonucleotide Synthesis Facility at the Medical
University of South Carolina.
Plasmid constructions. Constitutively active PKC-
A159E in
SRD vector (a kind gift of Dr. Shigeo Ohno, Yokohama City University School of
Medicine, Yokohama, Japan) was amplified by polymerase chain reaction
[5'CTAAGGATCCGCTATGGTAGTG (forward primer) and
5'GTATATCTCGAGTGGGCATCAG (reverse primer)], digested with
BamHI/XhoI, and ligated into pcDNA3.1/V5-His (Invitrogen)
using a standard procedure
(44). The structure of
construct was verified by nucleotide sequence analysis (Medical University of
South Carolina DNA Sequencing Core). HA-RhoA L63 was subcloned into
EcoRI- and BamHI-digested pcDNA3.1 as previously described
(6). pGEX expression vector
encoding the glutathione S-transferase (GST) fusion protein that
contains the isolated GTP-dependent RhoA-binding domain (RBD) of rhotekin was
kindly provided by Dr. Shuh Narumiya (Kyoto University Faculty of Medicine,
Kyoto, Japan) (32).
Cell culture. Lung fibroblasts were derived from normal lung tissues obtained at autopsy. Lung tissue was diced (0.5 x 0.5-mm pieces) and cultured in Dulbecco's modified Eagle's medium (DMEM; GIBCO, Grand Island, NY) supplemented with 10% fetal calf serum, 2 mM L-glutamine, gentamicin sulfate (50 µg/ml), and amphotericin B (5 µg/ml) at 37°C in 10% CO2. Medium was changed every 3 days to remove dead and nonattached cells until fibroblasts reached confluence. Monolayer cultures were maintained in the same medium. Lung fibroblasts were used between passages 2 and 4 in all experiments. Purity of isolated lung fibroblasts was determined by crystal violet staining (41) and by immunofluorescent staining: monoclonal antibody against human fibroblasts, as described previously (20), followed by FITC-conjugated goat anti-mouse IgG staining (Santa Cruz Biotechnology, Santa Cruz, CA).
Rho-35S-labeled guanosine
5'-O-(3-thiotriphosphate) binding.
Rho-35S-labeled guanosine 5'-O-(3-thiotriphosphate)
(GTP
S) binding assay was performed as described by Seasholtz et al.
(36) with some modifications.
Lung fibroblasts were grown to confluence on 100-mm dishes. In some
experiments, antisense oligonucleotide for PKC-
and appropriate sense
oligonucleotide (control) were introduced into the cells as described
previously (2,
21). Cells were harvested in
phosphate-buffered saline (PBS) containing (in mM) 137 NaCl, 2.6 KCl, 1.8
KH2PO4, and 10 Na2HPO4 (pH 7.4).
Cells were further pelleted at 220 g and lysed in lysis buffer (400
µl/plate) composed of 50 mM Tris (pH 7.4), 10 mM MgCl2, 2 mM
EDTA, 100 mM NaCl, 1 µM GDP, 20 µg/ml aprotinin, 10 µg/ml leupeptin,
and 100 µM phenylmethylsulfonyl fluoride. The lysates were homogenized with
a 1-ml syringe five to six times and spun at 220 g to remove unbroken
cells. Protein concentration of the supernatant was determined by using
Bio-Rad reagent. Rho-[35S]GTP
S binding was performed with 20
µg of protein in the presence or absence of thrombin (0.5 U/ml) in a total
volume of 50 µl of 300 nM [35S]GTP
S in lysis buffer at
30°C for 5 min. The reaction was terminated by the addition of 600 µl
of ice-cold immunoprecipitation buffer (50 mM Tris, pH 7.5, 20 mM
MgCl2, 150 mM NaCl, 0.5% NP-40, 20 µg/ml aprotinin, 100 µM
GDP, and 100 µM GTP) and immunoprecipitated with 2 µg of monoclonal
anti-Rho antibody (Santa Cruz Biotechnology). Immune complexes were isolated
on protein G-Sepharose beads (Amersham, Piscataway, NJ), washed, and boiled in
500 µl of 0.5% SDS for 1 min. Samples were transferred to vials containing
5 ml of Ecoscint A (National Diagnostics, Atlanta, GA) and analyzed by
scintillation spectrometry. In one set of experiments, antisense
oligonucleotide for PKC-
(5'-ATTGAACACTACCAT-3') and sense
oligonucleotide as a control (5'-ATGGTAGTGTTCCAAT-3') were
introduced into lung fibroblasts, as described elsewhere
(2,
21), 24 h before the cells
were harvested.
GST-rhotekin pull-down assay. Lung fibroblasts were grown to 70%
confluence on 100-mm dishes, deprived of serum overnight, and stimulated with
thrombin (0.5 U/ml) for up to 24 h. Cells were then harvested with PBS and
lysed with ice-cold buffer containing 50 mM Tris (pH 7.2), 1% Triton X-100,
0.5% sodium deoxycholate, 0.1% SDS, 100 mM NaCl, 20 mM MgCl2, 40 mM
-glycerophosphate, 10 µg/ml aprotinin, 10 µg/ml leupeptin, and 100
mM phenylmethylsulfonyl fluoride. Cell lysates were incubated with GST fusion
RBD of the RhoA effector rhotekin previously bound to GST beads for 1 h. The
GST beads were washed four times with lysis buffer and subjected to 12%
SDS-PAGE. Bound RhoA was detected with anti-RhoA monoclonal antibody (Santa
Cruz Biotechnology).
Preparation of collagen lattices and measurement of collagen gel
contraction by lung fibroblasts. Collagen lattices were prepared by using
type I collagen as described previously
(2). To initiate collagen gel
contraction, polymerized gels were gently released from the underlying culture
dish, and cells were immediately stimulated with 0.5 U/ml of thrombin in
serum-free DMEM or pretreated with pertussis toxin or toxin B for 24 h and
then stimulated with thrombin. The degree of collagen gel contraction was
determined after 2 h. Pictures were taken with a digital camera (model
EDAS-120, Eastman Kodak, Rochester, NY). The diameter of the gels was measured
in millimeters and recorded as the average value of the major and minor axes.
In some experiments, cells were transfected with constitutively active
V5/His-PKC-
A159E or HA-RhoA L63 by Effectene reagent (Qiagen, Valencia,
CA) according to the manufacturer's instructions. Briefly, lung fibroblasts on
100-mm dishes were transfected with V5/His-PKC-
in pcDNA3.1 and pcDNA3.1
(2.5 µg each), with HARhoA L63 in pcDNA3.1 and pcDNA3.1 (2.5 µg each),
or with V5/His-PKC-
in pcDNA3.1 and HA-RhoA L63 in pcDNA3.1 (2.5 µg
each). Control cells were transfected with pcDNA3.1 (5 µg). Cells were
washed with PBS and incubated overnight with 10 ml of growth medium containing
the indicated amount of DNA and Effectene reagent (60 µl). Cells were then
collected, suspended in collagen gel (2.5 x 105 cells/ml
final concentration), and aliquoted into 24-well plates. The degree of
collagen gel contraction was determined 48 h after transfection. To determine
expression of SM
-actin, as well as V5/His-PKC-
A159E and HA-RhoA
L63, collagen gels were collected, digested with collagenase, and analyzed by
Western blot by using anti-SM
-actin antibody, anti-V5 antibody, and
anti-HA antibody, respectively.
Coimmunoprecipitation experiments. Immunoprecipitation was
performed as described previously
(2). Briefly, lung fibroblasts
were grown to confluence, kept in serum-free DMEM overnight, and then treated
with thrombin (0.5 U/ml) for 5 min, 15 min, 2 h, and 24 h. In one set of
experiments, cells were pretreated with or without toxin B (50 pg/ml) for 18 h
and then stimulated with or without thrombin (0.5 U/ml) for 2 h. In another
set of experiments, cells were pretreated with PKC-
TIP or TIPN as
previously described (2).
Briefly, TIP or TIPN (each 150 µg/ml) was introduced into the permeabilized
cells with saponin (50 µg/ml), and then the cells were treated with
thrombin (0.5 U/ml for 2 h). The cells were washed with ice-cold PBS and
collected with 1 ml of ice-cold solubilization buffer (10 mM Tris, 10 mM EDTA,
500 mM NaCl, 1% NP-40, 0.5% deoxycholate, and 0.1% SDS, pH 7.4). Samples were
rotated for 3 h and then cleared by microcentrifugation at 4°C. Twenty
microliters of the lysates were saved for Western analysis. Anti-SM
-actin monoclonal antibody (Oncogene Research Products, Boston, MA) or
anti-Rho polyclonal antibody (Upstate Biotechnology, Lake Placid, NY) was
added, and the samples were rotated for an additional 90 min at 4°C.
Immune complexes were isolated on protein G-Sepharose beads (Amersham) and
washed once with solubilization buffer and three times with buffer containing
10 mM Tris and 10 mM EDTA (pH 7.4). Isolated immune complexes were then
resolved on 6% and 12% SDS-PAGE and immunoblotted with anti-PKC-
and
anti-RhoA antibodies.
Distribution and translocation of PKC-
in lung
fibroblasts. PKC-
translocation assay was performed as described
previously (2,
41). Briefly, lung fibroblasts
were grown to confluence, pretreated with or without toxin B (50 pg/ml)
overnight, and then treated with thrombin (0.5 U/ml) for 15 min. Cells were
collected in ice-cold PBS and divided into membrane and cytosolic fractions as
described elsewhere (2). Forty
micrograms of protein from each fraction were then analyzed for PKC-
expression by Western blotting.
Confocal microscopy. Lung fibroblasts were cultured to
subconfluence on glass slides in DMEM containing 10% fetal calf serum. Cells
were stimulated with or without thrombin (0.5 U/ml) for 24 h, washed with cold
PBS, fixed in methanol, and immunostained with SM
-actin monoclonal
antibody. Cyanine (Cy2) anti-mouse IgG (Jackson Immuno-Research) was used as
secondary antibody at 1 µg/ml for 1 h at room temperature. For one series
of experiments, cells were transfected with constitutively active
V5/His-PKC-
A159E in pcDNA3.1 or HA-RhoA L63 in pcDNA3.1 by Effectene
reagent according to the manufacturer's instructions. An equal amount of DNA
(1 µg) was introduced into the cells on each slide. Lung fibroblasts were
transfected with V5/His-PKC-
in pcDNA3.1 and pcDNA3.1 (0.5 µg each),
with HA-RhoA L63 in pcDNA3.1 and pcDNA3.1 (0.5 µg each), or with
V5/His-PKC-
in pcDNA3.1 and HA-RhoA L63 in pcDNA3.1 (0.5 µg each).
Control cells were transfected with pcDNA3.1 (1 µg). Cells were washed with
PBS and incubated overnight with 1.5 ml of growth medium containing the
indicated amount of DNA and Effectene reagent (10 µl). Then cells were
washed and allowed to grow in fresh medium for another 24 h. In addition to SM
-actin, cells were stained with rabbit polyclonal His probe (catalog
no. sc-803, Santa Cruz Biotechnology) and with goat polyclonal HA probe
(catalog no. sc-805-G, Santa Cruz Biotechnology) and then with
indodicarbocyanine (Cy5) anti-rabbit IgG and indocarbocyanine (Cy3) anti-goat
IgG. Confocal microscopy was performed by using an Olympus Merlin Imaging
System (Life Science Resource, Melville, NY).
| RESULTS |
|---|
|
|
|---|
S to RhoA isolated
subsequently by immunoprecipitation
(36). We found that thrombin
rapidly activates Rho in a concentration-dependent manner
(Fig. 1A). Thrombin,
at a concentration as low as 0.01 U/ml, produced a significant increase in
Rho-[35S]GTP
S binding. The maximum activation of Rho
occurred in the presence of 0.5 U/ml of thrombin when
[35S]GTP
S binding reached 1,600 cpm, or
5.2-fold over
basal levels. Further increases in thrombin concentrations up to 5 U/ml did
not significantly change Rho-GTP
S binding.
|
These results suggest that, in thrombin-treated lung fibroblasts, inactive GDP-bound Rho is converted to the GTP-bound form, which is able to interact directly with RBD of the RhoA effector rhotekin. To demonstrate that thrombin indeed stimulates Rho activity in intact lung fibroblasts, we performed a Rho guanine nucleotide exchange assay in vivo (33). Lung fibroblasts were incubated with thrombin (0.5 U/ml), and the levels of the GTP-bound form of Rho associated with GST-RBD of rhotekin were detected by Western blot with an anti-Rho antibody. Time-course analysis of Rho stimulations by thrombin showed the rapid and potent activation of Rho, which was maximal in 25 min after thrombin addition and remained above basal levels for up to 24 h (Fig. 1B).
Rho inactivation prevents SM
-actin organization and
collagen gel contraction in lung fibroblasts. Rho protein has been
implicated in cytoskeletal reorganization and stress fiber formation
(34). Because SM
-actin
in activated fibroblasts has been shown to be incorporated mainly into stress
fibers (8,
10), Rho may be one of the
proteins responsible for SM
-actin expression and organization. To test
whether Rho is indeed involved in thrombin-mediated lung fibroblast
differentiation, we employed C. difficille toxin B, which
monoglucosylates and inactivates Rho proteins. As we previously reported, lung
fibroblasts express small amounts of SM
-actin that is not fully
organized (2). After 24 h of
thrombin treatment, such cells express large amounts of highly organized SM
-actin, similar to our observation in scleroderma lung fibroblasts,
which, without any treatment, express highly organized SM
-actin.
Pretreatment of cells with toxin B for 18 h completely prevented organization
of thrombin-induced SM
-actin in lung fibroblasts without interfering
with SM
-actin expression (Fig.
2).
|
Another typical feature of myofibroblasts, their contractile activity,
depends on SM
-actin expression and organization
(29,
45). Recently, we demonstrated
that thrombin rapidly induced collagen gel contraction by normal lung
fibroblasts, whereas SSc myofibroblasts contracted collagen gels without any
treatment (2). Inactivation of
Rho proteins by pretreatment of the cells with toxin B for 18 h abolished
thrombin-induced collagen gel contraction by normal lung fibroblasts
(Fig. 3A). The levels
of SM
-actin in collagen gels were increased after thrombin stimulation
but were not dependent on toxin B treatment
(Fig. 3B). We conclude
that GTP-binding Rho protein is essential for SM
-actin organization,
but not for its expression.
|
Interaction of Rho protein with PKC-
and SM
-actin. On the basis of our results showing that the presence
of active Rho is essential for SM
-actin organization, we investigated
whether Rho protein could associate with PKC-
in lung fibroblasts. Lung
fibroblasts were stimulated with thrombin for 5 min, 15 min, 2 h, and 24 h,
immunoprecipitated with anti-RhoA antibody, and then immunoblotted with
anti-PKC-
antibody. We found that Rho protein coimmunoprecipitates with
PKC-
rapidly, within 5 min of thrombin treatment
(Fig. 4A).
Furthermore, we demonstrated that association of RhoA with PKC-
was
transient and disappeared after incubation of lung fibroblasts with thrombin
for
2 h. We also immunoprecipitated lung fibroblasts with anti-SM
-actin antibody and then immunoblotted them with anti-PKC-
and
anti-RhoA antibodies. We found that, after 5 min of thrombin treatment,
neither PKC-
nor RhoA associated with SM
-actin
(Fig. 4, B and
C, left). Incubation with thrombin for 15 min
resulted in coimmunoprecipitation of PKC-
with SM
-actin. A
longer stimulation (
2 h) with thrombin was required for protein
coimmunoprecipitation of SM
-actin and RhoA
(Fig. 4C,
left).
|
PKC isoforms have been shown to have specific subcellular localizations
before their activation. Inactive PKC isoforms are localized in cytosol, and
after activation they translocate to the plasma membrane and/or cytoskeleton
(30). To establish whether
inhibition of PKC-
activation affects thrombin-induced complex formation
between SM
-actin and PKC or RhoA, we employed specific TIP for
PKC-
to inhibit its activation. We found that inhibition of PKC-
translocation completely abolished interaction among all three molecules
(Fig. 4, B and
C, right). The Rho inhibitor toxin B had the
same effect. We hypothesize that, in thrombin-activated lung fibroblasts,
PKC-
and RhoA rapidly associate, SM
-actin is recruited, and a
ternary complex is formed. PKC-
-RhoA-SM
-actin leads to
differentiation of normal lung fibroblasts to a myofibroblast phenotype
(Fig. 5).
|
Several recent studies have demonstrated that some PKC isoforms are
required for activation of Rho family members
(9,
26). Previously, we showed
that thrombin treatment activates and translocates PKC-
to the plasma
membrane in lung fibroblasts
(2). To establish whether
inhibition of Rho proteins affects PKC-
activation and translocation to
the membrane, we treated lung fibroblasts with toxin B for 18 h and then
performed a PKC translocation assay. Interestingly, toxin B did not interfere
with thrombin-induced PKC translocation to the membrane
(Fig. 6A). To
determine whether PKC-
might regulate Rho activity, we performed a
Rho-GTP
S binding assay after depletion of PKC-
in lung
fibroblasts by using antisense oligonucleotides. The protein level of
PKC-
in cells treated with antisense oligonucleotides was decreased by
7080% compared with untreated cells or cells treated with sense
oligonucleotides for PKC-
(Fig.
6B, top). Depletion of PKC-
did not change
thrombin-induced Rho-GTP
S binding in lung fibroblast lysates
(Fig. 6B,
bottom).
|
Overexpression of constitutively active PKC-
A159E and
RhoA L63 mimics thrombin's effects on SM
-actin
expression/organization and collagen gel contraction in normal lung
fibroblasts. Our results suggest that thrombin activates Rho protein and
PKC-
in lung fibroblasts in an independent manner. We postulated that
activated RhoA and PKC-
associate with one another and then are capable
of mimicking the effects of thrombin on SM
-actin rearrangements in
human lung fibroblasts. To test this hypothesis, we employed constitutively
active PKC-
and RhoA to transiently transfect cultured lung fibroblasts.
The substitution of leucine at position 63 for glycine abolished
GTPase activity of RhoA and resulted in a constitutively active form
(6). The substitution of
glutamic acid at position 159 for alanine in PKC-
's
pseudosubstrate motif of the regulatory domain prevented inhibition of the
catalytic domain and resulted in constitutive activity of PKC-
(9). SM
-actin
expression and organization, as well as overexpression of constitutively
active V5/His-PKC-
A159E and HA-RhoA L63, were analyzed by confocal
microscopy 48 h after transfection. To provide compelling evidence that lung
fibroblasts examined by confocal microscopy indeed expressed introduced DNA,
we immunostained the cells simultaneously with anti-SM
-actin,
anti-His, and anti-HA antibodies (Fig.
7). Cells transfected with constitutively active V5/His-PKC-
A159E alone (top row, 2nd column) and cells transfected with both
constitutively active PKC-
and constitutively active RhoA (top row,
4th column) expressed PKC-
(blue staining with anti-His antibody).
PKC-
was not expressed when cells were transfected with vector or
constitutively active RhoA alone (top row, 1st and 3rd
columns). Cells transfected with constitutively active HA-RhoA L63 alone
and cells transfected with both constitutively active PKC-
and
constitutively active RhoA expressed RhoA (red staining with anti-HA antibody,
middle row, 3rd and 4th columns). Cells transfected with
vector or PKC-
alone did not express RhoA (middle row, 1st and
2nd columns). SM
-actin was expressed only in cells
transfected with constitutively active forms of PKC-
and RhoA
(bottom row, 4th column), suggesting that expression and organization
of SM
-actin occurs only in the presence of activated PKC-
and
RhoA. Cells transfected with either vector or constitutively active PKC-
alone or constitutively active RhoA alone contained only traces of unorganized
SM
-actin (bottom row, 1st3rd columns). Lung
fibroblasts transfected with V5/His-PKC-
A159E or HA-RhoA L63 alone did
not contract collagen gels in serum-free DMEM, whereas gels containing cells
transfected with constitutively active forms of PKC-
and RhoA contracted
from
15 to 76 mm diameter (Fig.
8A). Contraction was apparent within 25 h after
release of polymerized gels from the underlying culture dish and reached a
maximum within 24 h. On the basis of the fact that thrombin-induced SM
-actin expression/organization and contractile phenotype of fibroblasts
require PKC-
and RhoA, we expected that lung fibroblasts transfected
with constitutively active forms of PKC-
and RhoA and cultured in
three-dimensional collagen gels will contain significant amounts of SM
-actin. To determine expression of SM
-actin, as well as
V5/His-PKC-
A159E and HA-RhoA L63, collagen gels were collected,
digested with collagenase, and analyzed by Western blot using anti-SM
-actin antibody, anti-V5 antibody, and anti-HA antibody, respectively
(Fig. 8B).
Immunoblotting confirmed that SM
-actin expression was significantly
increased in cells transfected with constitutively active forms of PKC-
and RhoA compared with the cells transfected with vector, PKC-
alone, or
RhoA alone (Fig. 8B).
We conclude that coexpression of constitutively active PKC-
and RhoA
mimics the effect of thrombin in normal lung fibroblasts, namely, promoting SM
-actin expression/organization and collagen gel contraction, two
fundamental elements of myofibroblast differentiation.
|
|
| DISCUSSION |
|---|
|
|
|---|
mediates thrombin-induced SM
-actin expression and organization and differentiates lung fibroblasts
to a myofibroblast phenotype
(2). Similar cells can be
cultured from bronchoalveolar lavage (BAL) fluid or obtained at autopsy from
scleroderma patients with interstitial pulmonary fibrosis
(20). The factors regulating
SM
-actin expression and organization in lung fibroblasts, which are
involved in the process of pulmonary fibrosis, are not yet understood. In a
previous study, we demonstrated that depletion of PKC-
or inhibition of
its activation abolished thrombin-induced SM
-expression/organization
and collagen gel contraction by lung fibroblasts
(2). In this study, we found
that overexpression of constitutively active PKC-
alone does not affect
SM
-actin expression and organization or collagen gel contraction.
Therefore, we speculate that some other protein(s) is activated in lung
fibroblasts by thrombin, which is involved in myofibroblast differentiation. A
potential candidate is the small GTP-binding protein Rho, which is activated
by thrombin in different cell lines
(7,
25,
36). We observed that thrombin
rapidly activates Rho and increases Rho-[35S]GTP
S binding up
to 5.2 times basal levels in lung fibroblasts. Time-course analysis of Rho
stimulation in vivo revealed that Rho remained activated for 24 h after
exposure of lung fibroblasts to thrombin.
Recent publications support an important role for Rho GTPase in
cytoskeletal reorganization
(16,
27). Microinjection studies
performed in fibroblasts showed that Rho mediates stress fiber formation, and
inhibition of Rho prevents stress fiber formation in response to
lysophosphatidic acid and bombesin
(3,
31). We found that Rho
inactivation inhibits SM
-actin organization and collagen gel
contraction by lung fibroblasts. This is consistent with the fact that SM
-actin in activated lung fibroblasts is chiefly incorporated in stress
fibers. Furthermore, we showed that inhibition of Rho proteins by toxin B
abolished interaction between SM
-actin and PKC-
. This effect is
not due to SM
-actin disorganization but, rather, direct involvement of
RhoA, because, as we showed previously, the actin microfilament-disrupting
agent cytochalasin D does not affect complex formation between PKC-
and
SM
-actin (2).
With the use of a yeast two-hybrid system, direct interaction has been
shown between the yeast homolog of Rho protein, Rho1p, and the homolog of
mammalian PKC, Pkc1p (12).
Recent studies also provide evidence that mammalian PKC isozymes and Rho
GTPases coimmunoprecipitate and participate in direct protein-protein
interactions (5,
37,
39). On the basis of our
results showing that the presence of active Rho is essential for SM
-actin organization, we investigated whether Rho protein could
associate with PKC-
in lung fibroblasts. Using an immunoprecipitation
assay, we found that, after thrombin treatment, Rho protein rapidly, but
transiently, coimmunoprecipitates with PKC-
. A longer (
2 h)
stimulation with thrombin was required for protein coimmunoprecipitation of
Rho and SM
-actin. PKC-
and RhoA remain associated with SM
-actin after 2 and 24 h of exposure to thrombin. We hypothesize that,
in thrombin-activated lung fibroblasts, PKC-
and RhoA rapidly associate,
recruit SM
-actin, and form the ternary complex. However, we were not
able to coimmunoprecipitate PKC with anti-Rho antibody after 2 and 24 h of
thrombin stimulation, whereas PKC and Rho were easily detected after 2 and 24
h of thrombin treatment, when coimmunoprecipitation was performed with anti-SM
-actin antibody. We believe that PKC-
could not be detected in
association with RhoA, because, after 2 h of thrombin stimulation, there is no
longer direct interaction between Rho and PKC; however, Rho and PKC interact
with SM
-actin. It is also possible that during protein-protein
interaction between PKC and SM
-actin, some changes in PKC conformation
occur that make it unavailable for anti-PKC antibody, when immunoprecipitation
is performed with anti-RhoA antibody.
We assumed that association of Rho GTPase and PKC-
in lung
fibroblasts might be necessary for activation of one another or for regulation
of a common signaling pathway(s) downstream from the Rho-PKC signal
transduction complex. Recently, the association of PKC-
with Rho was
demonstrated in endothelial cells, suggesting its critical role in Rho
activation (25). However, we
observed that Rho protein was not necessary for thrombin-induced PKC-
activation and translocation to the membrane, nor did depletion of PKC-
affect Rho activation and thrombin-induced GTP
S binding. On the other
hand, Rho inhibition prevented coimmunoprecipitation of PKC-
with SM
-actin. This suggests that the association of thrombin-activated Rho
and PKC is essential for the regulation of SM
-actin organization in
normal lung fibroblasts. We postulated that constitutively active RhoA and
PKC-
associate with one another and mimic the effects of thrombin on SM
-actin functions in lung fibroblasts. To test this hypothesis, we
overexpressed constitutively active PKC-
and constitutively active RhoA
in lung fibroblasts and compared their effects on SM
-actin with
nontransfected cells. We found that cells transfected with constitutively
active PKC-
alone appeared and behaved similar to control lung
fibroblasts. Cells transfected with constitutively active RhoA alone had only
slightly increased SM
-actin organization. Interestingly, lung
fibroblasts transfected with the combination of constitutively active
PKC-
and constitutively active RhoA contained highly organized SM
-actin. Transfected lung fibroblasts acquired the ability to contract
collagen gel in serum-free medium without any stimulation, similar to our
observation with SSc lung myofibroblasts
(2). We conclude that
PKC-
and RhoA in their active forms are required for SM
-actin
expression/organization and collagen gel contraction. It has been demonstrated
that Rho alone can increase the activity of SM
-actin promoter and
modulate SM
-actin expression in other cell types such as vascular
smooth muscle cells (22). Our
data suggest that Rho promotes SM
-actin expression only in the
presence of activated PKC-
in lung fibroblasts. The molecular link
between Rho and actin stress fiber formation has been recently identified
(1,
34). The downstream target of
Rho, Rho kinase, has been shown to directly phosphorylate myosin light chain,
which promotes interaction of myosin filaments with actin filaments and is
followed by stress fiber formation and increased contractility
(1,
14,
18). Thrombin has been shown
to promote actin reorganization in endothelial and astrocytoma cells via
Rho-dependent activation of myosin light chain but without PKC involvement
(23,
47). In the present study, we
confirm that PKC-
activation is required for thrombin-induced SM
-actin organization. Recently, we found that inhibition of PKC-
activation in lung fibroblasts prevents thrombin-induced SM
-actin
organization and contractility of lung fibroblasts
(2). However, overexpression of
constitutively active PKC-
alone was not sufficient to induce SM
-actin expression and organization; it was observed when only
constitutively active RhoA was overexpressed in lung fibroblasts.
Overexpression of constitutively active RhoA and constitutively active
PKC-
promoted SM
-actin expression, organization, and collagen
gel contraction mimicking thrombin's effects in these cells. These data
suggest that PKC-
in association with RhoA recruits SM
-actin and
possibly some other protein(s) to promote intracellular events responsible for
SM
-actin expression and organization. Our study demonstrates for the
first time an apparent link between PKC-
- and Rho-mediated signaling
pathways, which is an essential intracellular connection in differentiation of
normal lung fibroblasts to a myofibroblast phenotype by thrombin.
| ACKNOWLEDGMENTS |
|---|
This work was supported by National Institutes of Health Grant RR-1070-1 (to R. M. Silver) and National Research Service Award 1 F32 HL-69689-01 (to G. S. Bogatkevich), a grant from the Scleroderma Foundation (to A. Ludwicka-Bradley and E. Tourkina), and a grant from the R. G. Kozmetsky Foundation (to R. M. Silver). An Olympus Merlin confocal imaging system from a Department of Veterans Affairs shared equipment grant and the Research Enhancement Award Program from the Department of Veterans Affairs was used for this study.
| FOOTNOTES |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
| REFERENCES |
|---|
|
|
|---|
12 and
G
13 stimulate Rho-dependent stress fiber formation and focal
adhesion assembly. J Biol Chem
270: 2463124634,
1995.
by a Rac- and Rho-dependent pathway. J Biol
Chem 276:
3405934065, 2001.
activation. Am J Respir Cell Mol Biol
22: 235243,
2000.
signals Rho-guanine nucleotide
dissociation inhibitor phosphorylation and Rho activation and regulates the
endothelial cell barrier function. J Biol Chem
276: 2261422620,
2001.
and filamentous actin.
J Biol Chem 273:
2679026798, 1998.
and RhoA
translocation in differentiated smooth muscle by a caveolin scaffolding domain
peptide. Exp Cell Res 258:
7281, 2000.[ISI][Medline]
-smooth muscle actin expression during bleomycin-induced pulmonary
fibrosis. Am J Pathol 143:
17541765, 1993.[Abstract]

binding sites in the third intracellular loop
of the M3-muscarinic receptor and their role in receptor
regulation. J Biol Chem 275:
90269034, 2000.
-smooth muscle actin expression and contractile phenotype in
bleomycin-induced pulmonary fibrosis. Am J Pathol
148: 527537,
1996.[Abstract]
This article has been cited by other articles:
![]() |
T. Kita, Y. Hata, R. Arita, S. Kawahara, M. Miura, S. Nakao, Y. Mochizuki, H. Enaida, Y. Goto, H. Shimokawa, et al. Role of TGF-{beta} in proliferative vitreoretinal diseases and ROCK as a therapeutic target PNAS, November 11, 2008; 105(45): 17504 - 17509. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Leask, X. Shi-wen, K. Khan, Y. Chen, A. Holmes, M. Eastwood, C. P. Denton, C. M. Black, and D. J. Abraham Loss of protein kinase C{epsilon} results in impaired cutaneous wound closure and myofibroblast function J. Cell Sci., October 15, 2008; 121(20): 3459 - 3467. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Smani, T. Patel, and V. M. Bolotina Complex regulation of store-operated Ca2+ entry pathway by PKC-{varepsilon} in vascular SMCs Am J Physiol Cell Physiol, June 1, 2008; 294(6): C1499 - C1508. [Abstract] [Full Text] [PDF] |