AJP - Lung Watch the video to learn how APS reaches out to developing nations.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Lung Cell Mol Physiol 285: L464-L475, 2003. First published April 25, 2003; doi:10.1152/ajplung.00031.2003
1040-0605/03 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
285/2/L464    most recent
00031.2003v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (43)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Li, L.-F.
Right arrow Articles by Quinn, D. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Li, L.-F.
Right arrow Articles by Quinn, D. A.

Stretch-induced IL-8 depends on c-Jun NH2-terminal and nuclear factor-{kappa}B-inducing kinases

Li-Fu Li,1,2 Bin Ouyang,1 Gabriel Choukroun,1,3 Robina Matyal,1 Marcella Mascarenhas,1 Behrouz Jafari,1 Joseph V. Bonventre,1 Thomas Force,4 and Deborah A. Quinn1

1Pulmonary and Critical Care and Renal Units, Department of Medicine, Massachusetts General Hospital, and Harvard Medical School, Boston 02114; 4Molecular Cardiology Research Institute, Tufts New England Medical Center and Department of Medicine, Tufts University School of Medicine, Boston, Massachusetts 02111; 2Chang Gung University, Tao-Yuan 333, Taiwan; and 3Internal Medicine and Nephrology Department, Amiens Hospital, 80054 Amiens, France

Submitted 31 January 2003 ; accepted in final form 21 April 2003


    ABSTRACT
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Positive pressure ventilation with large tidal volumes has been shown to cause release of cytokines, including interleukin (IL)-8. The mechanisms regulating lung stretch-induced cytokine production are unclear. We hypothesized that stretch-induced IL-8 production is dependent on the activation of the mitogen-activated protein kinases, c-Jun NH2-terminal kinases (JNK), p38, and/or extracellular signal-regulated kinase (ERK) 1/2. We exposed A549 cells, a type II-like alveolar epithelial cell line, to cyclic stretch at 20 cycles/min for 5 min–2 h. Cyclic stretch induced IL-8 protein production, IL-8 mRNA expression, and JNK activation, but only transient activation of p38 and ERK1/2. Inhibition of stretch-induced JNK activation by adenovirus-mediated gene transfer of stress-activated protein kinase (SEK-1), a dominant-negative mutant of SEK-1, the immediate upstream activator of the JNKs, and pharmacological JNK inhibitor II SP-600125 blocked IL-8 mRNA expression and attenuated IL-8 production. Inhibition of p38 and ERK1/2 did not affect stretch-induced IL-8 production. Stretch-induced activation NF-{kappa}B and activator protein (AP)-1 was blocked by NF-{kappa}B inhibitor and JNK inhibitor, respectively. An NF-IL-6 site was not essential for cyclic stretch-induced IL-8 promoter activity. Stretch also induced NF-{kappa}B-inducing kinase (NIK) activation, and inhibition of NF-{kappa}B attenuated IL-8 mRNA expression and IL-8 production. We conclude that stretch-induced transcriptional regulation of IL-8 mRNA and IL-8 production was via activation of AP-1 and NF-{kappa}B and was dependent on JNK and NIK activation, respectively.

A549 cells; mitogen-activated protein kinase; ventilation


POSITIVE PRESSURE VENTILATION can result in overdistention of alveoli in lung regions with the lowest airway resistance and the highest compliance. In acute respiratory distress syndrome (ARDS), which is an inhomogeneous disease (26), some lung units are more diseased than others and, therefore, are less compliant. Because only a small portion of the lung is compliant and ventilated in ARDS, the potential for overdistention of more compliant areas of lung is great, even with the use of moderate-sized tidal volumes. Animal data suggest that ventilation with high tidal volumes leads to ventilator-induced lung injury (VILI). VILI is characterized by noncardiogenic pulmonary edema, release of cytokines, and influx of neutrophils (8, 32, 41).

The ARDS Network clinical trial (861 patients) of large-volume ventilation vs. small-volume ventilation was stopped early because 22% fewer deaths were found in the patients ventilated with smaller tidal volumes (1a). The use of smaller tidal volumes in humans leads to reduced concentrations of polymorphonuclear cells, tumor necrosis factor-{alpha} (TNF-{alpha}), IL-1{beta}, and IL-8 in the bronchoalveolar lavage fluid (33). The exact mechanism of large volume ventilation-induced cytokine release is unclear. Understanding these mechanisms may lead to new treatment strategies. In vitro stretch of lung cells has been used to explore the possible mechanisms.

Intracellular messengers that are activated by mechanical cell stretch include the mitogen-activated protein kinases (MAPKs) (14, 18, 22, 36). MAPKs include the growth factor responsive MAPKs, extracellular signal-regulated kinases (ERK) 1/2, stress-responsive MAPKs, c-Jun NH2-terminal kinase (JNKs, also known as stress-activated protein kinases), and the p38s (9). On the basis of studies employing pharmacological inhibitors, osmotic stress-induced IL-8 production by neutrophils and TNF-{alpha} and IL-1{beta} regulation of IL-8 in vascular endothelial cells have been reported to be dependent on p38 activation (11, 37). However, these studies used inhibitors that have also been found to inhibit several JNK isoforms (7). More recently, in bronchial epithelial cells, stretch was found to activate JNK, ERK1/2, and p38. Furthermore, ERK1/2 and p38 were found to play a role in stretch-induced IL-8 production, but whether the JNKs mediate IL-8 production could not be evaluated due to the lack of specific inhibitors of the JNK pathway (30). Importantly, in vivo studies of lung stretch found activation of JNK and ERK1/2 but not p38 (43).

The transcription of IL-8 is regulated by several transcription factors. The 5' regulatory region of the IL-8 gene includes binding sites for nuclear factor (NF)-{kappa}B, NF-IL-6, and activator protein (AP)-1 (13, 28). In bronchial epithelial cells, cyclic stretch was found to activate AP-1 (30). NF-{kappa}B-inducing kinase (NIK), an ERK-related kinase, also has been shown to regulate NF-{kappa}B activation (20, 23). The transcription factors involved in stretch-induced IL-8 production and the role of NIK in regulating these factors have not been fully explored.

To begin to understand the role of JNK and NIK and transcription factors NF-{kappa}B, AP-1, and NF-IL-6 in stretch-induced IL-8 production, we explored how lung cell stretch induces IL-8 production. We hypothesized that stretch-induced IL-8 production would be dependent on the JNK/AP-1 and NIK/NF-{kappa}B pathways. We compared nonstretched static cells, cells exposed to a low level of stretch to mimic low tidal volume breathing and those exposed to a high level of stretch to mimic high tidal volumes seen in VILI. We used adenovirus-mediated gene transfer of a dominant inhibitory mutant of SEK-1, the immediate upstream activator of the JNKs, and various pharmacological inhibitors to inhibit the JNK, NIK, and NF-{kappa}B. We found that stretch induced IL-8 mRNA expression and IL-8 protein production, which were dependent on JNK and NIK activation of transcription factors AP-1 and NF-{kappa}B, respectively.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Cell stretch. Human type II-like alveolar epithelial cells (A549 cells) were purchased from American Type Culture Collection (ATCC, Manassas, VA). A549 cells were grown in F-12K Nutrient Mixture-Kaighn's Modification (GIBCOBRL, Grand Island, NY) containing 10% FBS, penicillin (100 U/ml), streptomycin (100 µg/ml), and amphotericin B (25 µg/ml) at 37°C in 5% CO2 and used in passages 4–7 after receipt from ATCC.

Two to three days before use, A549 cells were seeded at 3 x 106 cells/plate on membrane dishes for use in the mechanical strain device. These dishes consist of a plastic cylinder (100-mm diameter) with a circular silicone elastomeric membrane that serves as the culture surface. Fibronectin coating was used in A549 cells since expression of JNK and ERK1/2 has been found with fibronectin (22). On the day of stretching, medium was removed and replaced with serum-free medium to minimize the effect of residual growth factors. The plates were placed on the mechanical deformation device. The stretching device (U. S. patent no. 5,348,879, 1994) was provided by Dr. Martha Gray (Massachusetts Institute of Technology, Cambridge, MA) and has been described in detail (35). It provides a sinusoidal, spatially homogeneous, and isotropic biaxial strain to cultured cells. Strain is a measure of the degree of stretch and is expressed as the percentage of the change in cell length to resting cell length. By mathematical modeling, a change in lung volumes from 42% of the total lung capacity (TLC) to 64% of the TLC was associated with 32% of the alveolar surface area, which corresponded to 15% linear strain of alveolar cells. A change from 42 to 45% of TLC was associated with 4% of the alveolar surface area, corresponding to 2% linear strain. Cells were subjected to 20 cycles/min of either 2 or 15% strain for 5 min to 2 h. Parallel dishes of control cells were seeded identically and maintained without mechanical deformation. All experiments were performed in 5% CO2 at 37°C.

At the end of the experimental period, medium was removed and centrifuged at 3,000 rpm for 10 min, then the supernatant was aliquotted, flash-frozen, and stored at -70°C for further analysis of IL-8 production. For measurements of kinase activation, plates were washed with Hanks' balanced salt solution and 1 ml of lysis buffer [20 mM HEPES, pH 7.4, 1% Triton X, 10% glycerol, 2 mM EGTA, 50 µM {beta}-glycerophosphate, 1 mM sodium orthovanadate, 1 mM dithiothreitol (DTT), 400 µM aprotinin, and 400 µM phenylmethylsulfonyl fluoride (PMSF)] was added. Cells were removed by scraping, transferred to Eppendorf tubes, and placed on ice for 15 min. Tubes were centrifuged at 14,000 rpm for 10 min at 4°C and flash-frozen. For isolation of mRNA and Northern blot analysis, plates were rinsed with Hanks' balanced salt solution, treated with 3 ml of guanidine isothiocyanate with 2-mercaptoethanol, scraped, and frozen, or cells were lifted with trypsin-EDTA, pelleted, and lysed.

IL-8 production. IL-8 production was measured in cell supernatants by a commercially available kit (R&D Systems, Minneapolis, MN).

JNK activation. Cell lysates were matched for protein concentration (Bio-Rad, Richmond, CA) before assay. For measurement of JNK activation, cell lysates were immunoprecipitated with JNK1 antibody (Santa Cruz Biotechnology, Santa Cruz, CA), which recognizes all the JNK isoforms, for 2 h while rotating at 4°C. Immune complexes were collected with protein G-Sepharose beads for 1 h while rotating at 4°C. Kinase assays were performed with glutathione S-transferase (GST)-c-Jun as substrate (6). Samples were resolved by SDS-polyacrylamide gel electrophoresis, stained with Coomassie blue, exhaustively destained, dried, and analyzed with phosphoimaging (Cyclone; Packard Bioscience, Meriden, CT) or autoradiography. We utilized osmolar stress as a positive control for JNK activation (800 mosM NaCl).

Immunoblot analysis. Crude cell lysates were matched for protein concentration, resolved on a 10% bis-acrylamide gel, and electrotransferred to Immobilon-P membranes (Millipore, Bedford, MA). Blots were blocked overnight at 4°C with 5% dried milk in TBST (20 mM Tris, pH 7.6, 137 mM NaCl, and 0.1% Tween 20), incubated with appropriate antibody (1:1,000) for 2 h at room temperature, washed with TBST, blocked with 5% dried milk in TBST, and incubated with horseradish peroxidase-conjugated anti-rabbit IgG (1:5,000) for 1 h at room temperature. Blots were developed by enhanced chemiluminescence (NEN Life Science Products, Boston, MA). For assay of ERK1/2 and p38 phosphorylation, Western blot analysis was performed with antibodies to phospho-ERK1/2 and phospho-p38 (New England BioLabs, Beverly, MA). For determination of JNK, ERK1/2, and p38 protein expression, Western blot analysis was performed with the respective antibodies (Santa Cruz Biotechnology). Positive controls for ERK1/2 and p38 activation were performed with 25 ng/ml of PMA and 800 mosM NaCl, respectively. mRNA isolation and Northern blot analysis. Total cellular RNA was isolated from the cells in 4 M guanidine hydrochloride followed by purification over a 5.7 M CsCl2 gradient (5) or was isolated with RNAqueous, a small-scale phenol-free total RNA isolation kit (Ambion, Austin, TX) according to the manufacturer's directions. Total RNA was fractionated on a 1.2% agarose gel containing 7% formaldehyde, transferred to Hybond-N (Amersham Life Science, Buckinghamshire, UK), and hybridized with [32P]dCTP Klenow-labeled random-primed mouse IL-8 cDNA probes. GAPDH mRNA was used to ensure equal loading.

Construction of adenoviral vectors. SEK-1 (KR) was produced by an overlapping PCR method using a mutant PCR primer to produce an A-to-G transposition at nucleotide 414, resulting in a Lys-to-Arg substitution at lysine 129 (34). The recombinant adenovirus encoding SEK-1 (KR) with a respiratory syncytial virus (RSV) promoter (AdSEK) was prepared as previously described (6). SEK-1 (KR) has been shown to be specific for JNK and did not affect p38 or ERK1/2 activation (34). The recombinant adenovirus carrying the Escherichia coli LacZ gene encoding {beta}-galactosidase (AdLacZ) with an RSV promoter was kindly provided by David Dichek (University of Washington, Seattle, WA) (6). Multiplicity of infection (MOI) of 30–300 was employed, and expression of SEK-1 (KR) was measured by Western blot analysis with antibody to SEK-1 (MEK-4 K-18; Santa Cruz Biotechnology).

Transfections and chloramphenicol acetyl transferase assays. A549 cells were transiently transfected with a wild-type IL-8 promoter construct with a chloramphenicol acetyl transferase (CAT) reporter using Lipofectamine (Invitrogen, Carlsbad, CA). Dr. Charles Kunsch provided wild-type and mutated IL-8 promoter construct of NF-{kappa}B, NF-IL-6 (Atherogenics, Norcross, GA) (16), and Dr. Naofumi Mukaida (Kanazawa Univ., Tokyo, Japan) provided wild type and AP-1 mutant (28). After stretch, CAT expression was measured by ELISA (Roche Molecular Biochemicals, Mannheim, Germany) on 100 µg of protein lysate as previously described (4). To correct for variations in transfection efficiency, we tested each construct at least three times with separate plasmid preparations in three independent experiments and normalized CAT activity by pCMV-{beta}-galactosidase activity.

The combination of adenoviral infection and plasmid transfection with Lipofectamine was toxic to the cells. Therefore, to examine the role of JNK pathway in IL-8 promoter activity experiments, we used JNK inhibitor II (SP-600125; Calbiochem, La Jolla, CA). Unlike older nonspecific inhibitors, this pharmacological inhibitor has been shown to be relatively specific for JNK activity at the concentrations used herein (2, 10).

Other pharmacological inhibitors. Bisindolylmaleimide I hydrochloride (GF-109203X, 5 µM; Sigma Chemical, St. Louis, MO), a protein kinase C (PKC) inhibitor, was used to inhibit NIK expression (25, 42). p38 inhibitor (SB-203580, 1 µM; Calbiochem), ERK1/2 inhibitor (PD-98059, 25 µM; Calbiochem), and NF-{kappa}B inhibitor (SN-50, 50 µg/ml; Calbiochem) were used to explore the roles of p38, ERK1/2, and NF-{kappa}B (21). Cells were treated with SP-600125, GF-109203X, SB-203580, and PD-98059 in DMSO, and SN-50 in water, or equivalent amount of DMSO without inhibitors for 30 min to 3 h before stretch.

Extraction of nuclear proteins and EMSA analysis. The cellular pellet was resuspended in 10–20 times its volume in buffer A (lysis buffer) containing 50 mM KCl, 0.5% Igepal CA-630, 25 mM HEPES (pH 7.8), 1 mM PMSF, 2 µM leupeptin, 20 µg/ml aprotinin, 100 µM DTT and was subsequently incubated 5 min on ice. Cells were collected by centrifugation at 2,000 rpm, and the supernatant was decanted. The nuclei were washed in buffer A without Igepal CA-630, collected at 2,000 rpm, and resuspended in buffer B (extraction buffer) containing 500 mM KCl, 25 mM HEPES (pH 7.8), 10% glycerol, 1 mM PMSF, 2 µM leupeptin, 20 µg/ml aprotinin, and 100 µM DTT for 5 min on ice. The samples were subsequently frozen and thawed twice using dry ice and a 37°C water bath, rotating 20 min at 4°C, and centrifuged at 14,000 rpm for 20 min. The clear supernatant was collected, and nuclear protein concentration was measured by the Bradford method. EMSA was done with the Gel Shift Assay System (Promega, Madison, WI). In brief, nucleoproteins (10 µg) were incubated with [{gamma}-32P]ATP (3,000 Ci/mmol; Amersham Pharmacia Biotech) in a 15-µl reaction mixture containing 50 mM Tris (pH 7.5), 250 mM NaCl, 5 mM MgCl2, 2.5 mM EDTA, 2.5 mM DTT, 0.25 mg/ml poly(dI-dC), and 20% glycerol. The oligonucleotide sequences were as follows: NF-{kappa}B oligonucleotide (5'-AGTTGAGGGGACTTTCCCAGG-3'), AP-1 oligonucleotide [5'-d(C GCTTGATGAGTCAGCCGGAA)-3'], and NF-IL-6 oligonucleotide (5'-TGCAGATTGCGCAATCTGCA-3', from Santa Cruz Biotechnology). To complete the specific binding reactions, we added each of the 100-fold molar excesses of unlabeled oligonucleotides (cold oligonucleotide probe) to the binding mixture before addition of the labeled probe. Nucleoprotein complexes were resolved by electrophoresis on 4% nondenaturing polyacrylamide gels in 0.5x Tris borate-EDTA buffer at 100 V for 3 h at room temperature. Dried gels were exposed to Kodak XAP-5 film at -70°C with intensifying screens (38).

Statistical evaluation. The EMSA, Northern blots, and Western blots were quantitated using a National Institutes of Health (NIH) image analyzer ImageJ 1.27z (NIH, Bethesda, MD) and were presented as arbitrary units only, ratio of IL-8 mRNA to GAPDH, GST-c-Jun to JNKs, or phospho-MAPK to MAPK (relative phosphorylation). All results were normalized to static cells with medium or vehicle alone. Values were expressed as the means ± SE of at least three experiments. Data were analyzed with Statview 4.5 (Abacus Concepts; SAS Institute, Cary, NC). ANOVA was used to assess the statistical significance of the differences followed by multiple comparisons with a Scheffé's test, and a P value < 0.05 was considered statistically significant.


    RESULTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Cytokine production in cells exposed to cyclic stretch. We measured IL-8 production in cell supernatants after 2 and 15% strain for 2 h. After2hof cyclic stretch with serum deprivation, >80% of cells were attached to the membrane and were viable as measured by trypan blue exclusion. There was a dose-dependent and sustained time-dependent (Fig. 1) increase in IL-8 mRNA expression and IL-8 protein production. This suggested that cyclic stretch-induced IL-8 protein production was, at least in part, through increased expression of IL-8 mRNA.



View larger version (19K):
[in this window]
[in a new window]
 
Fig. 1. Cyclic stretch causes a dose-dependent and time-dependent increase in stretch-induced IL-8 mRNA expression and IL-8 production. A549 cells were exposed to medium only or 2 or 15% cyclic strain for 2 h. A: stretch-induced IL-8 mRNA, GAPDH mRNA, and arbitrary units (representative of n - 3 experiments). B: stretch-induced IL-8 protein production in cell supernatants (pg/ml, n - 4/group). C: stretch-induced IL-8 mRNA, GAPDH mRNA, and arbitrary units (representative of n - 3 experiments). D: stretch-induced IL-8 protein production in cell supernatants (n - 4/group). Arbitrary units were expressed as the ratio of IL-8 mRNA to GAPDH as described in MATERIALS AND METHODS. *P < 0.05 vs. static, nonstretched cells; {dagger}P < 0.05 vs. 2% strain.

 

Cell stretch-induced JNK and NIK activation. We measured activity of JNKs and NIK after 2 and 15% cyclic strain for 30 min. There was a dose-dependent increase in phosphorylation of JNKs but no change in the expression of JNK protein (Fig. 2A). There was also a dose-dependent increase in NIK protein expressions (Fig. 2B).



View larger version (27K):
[in this window]
[in a new window]
 
Fig. 2. Cyclic stretch causes a dose-dependent increase in JNK and NF-{kappa}B-inducing kinase (NIK) activities. A: Western blot of JNK phosphorylation (top), JNK protein expression (middle), and arbitrary units (bottom) (representative of n - 3 experiments). B: NIK protein expression (top) and arbitrary units (bottom) (representative of n - 3 experiments). Arbitrary units were expressed as relative phosphorylation or NIK protein expression as described in MATERIALS AND METHODS. *P < 0.05 vs. static, nonstretched cells; {dagger}P < 0.05 vs. 2% strain.

 

Cell stretch-induced MAPK activation. We measured activity of three families of MAPKs, JNKs, p38, and ERK1/2 in A549 cells exposed to 15% strain for 5 min to 2 h. Cyclic stretch of A549 cells resulted in a rapid activation of all three MAPKs but with markedly different time course of phosphorylation of MAPKs tested (Figs. 3A and 7, A and B). JNK activity was increased after 15 min of 15% strain stretch and further increased after 1 and 2 h of stretch. (Fig. 3A). There was no change in the expression of JNK protein, indicating an increase in JNK-specific activity (Fig. 3A). In contrast to JNK activity, activation of phospho-p38 and ERK1/2 lasted for 15 min and then decreased (Fig. 7, A and B).



View larger version (54K):
[in this window]
[in a new window]
 
Fig. 3. Cyclic stretch causes a time-dependent increase in JNK activity. JNK activity assay using glutathione S-transferase (GST)-c-Jun as a substrate (A, top). Western blot of JNK protein expression (A, middle) and arbitrary units (A, bottom) (representative of n - 3 experiments). Transfection with recombinant adenovirus endcoding SEK (AdSEK) caused increased expressions of the dominant-negative mutant from SEK-1 and SEK-1 (KR). Inhibition of JNK activity (B) and JNK phosphorylation (C) with AdSEK blocked stretch-induced IL-8 mRNA expression (D). Effects of transfection were controlled by using recombinant adenovirus carrying the Escherichia coli LacZ gene (AdLacZ, n - 4–6/group). Arbitrary units were expressed as the ratio of relative phosphorylation or IL-8 mRNA to GAPDH as described in MATERIALS AND METHODS. *P < 0.05 vs. static of respective indicated time period; {dagger}P < 0.05 vs. stretch with AdSEK. C, control; S, stretch with 15% strain.

 


View larger version (29K):
[in this window]
[in a new window]
 
Fig. 7. Cyclic stretch caused time-dependent increases in p38 and ERK1/2 activity, but p38 and ERK1/2 were not involved in stretch-induced IL-8 production. Western blot using antibody that recognizes the phosphorylated ERK1/2 or p38 expressions (A and B, top) and antibody that recognizes total ERK1/2 or p38 (A and B, middle) protein expressions, and arbitrary units (A and B, bottom) (representative of n - 2 experiments). Positive controls for ERK1/2 and p38 activation were performed with 25 ng/ml of PMA and 800 mosM NaCl, respectively. Arbitrary units were expressed as relative phosphorylation as described in MATERIALS AND METHODS. C: IL-8 protein production (pg/ml) in supernatants of static, nonstretched A549 cells and cells exposed to 15% cyclic strain for 2 h with or without pretreatment with SB-203580 (1 µM, p38 inhibitor) and PD-98059 (25 µM, ERK1/2 inhibitor) for 30 min (n - 4/group). *P < 0.05 vs. static, nonstretched cells. C, control; S, stretch with 15% strain; No Tx, no treatment.

 

JNK inhibition with a dominant-negative mutant of its upstream activator. Due to lack of specific pharmacological JNK inhibitors, it was difficult to explore the role of JNK activation in stretch-induced IL-8 production. To inhibit JNK activation, we infected A549 cells with adenovirus encoding the dominant-negative mutant of SEK-1, AdSEK, at 30–300 MOI (6). After 48 h, there was an increase of SEK-1 (KR) expression (Fig. 3B). Cells were infected with AdSEK or AdLacZ at 300 MOI for 48 h and subjected to 15% strain at 20 cycles/min for 1–2 h. Although gene transfer of adenoviral vector alone caused an increase in baseline expression of IL-8 protein, stretch caused a significant rise in IL-8 expression over and above the baseline in AdLacZ-transfected cells. Gene transfer with AdSEK significantly attenuated stretch-induced JNK activation by both kinase activity assay (Fig. 3B) and immunoblotting with phospo-specific JNK antibodies (Fig. 3C), IL-8 mRNA expression (Fig. 3D), and IL-8 protein production (Fig. 4). These data suggest that stretch-induced IL-8 expression is, at least in part, dependent on JNK activation.



View larger version (15K):
[in this window]
[in a new window]
 
Fig. 4. Inhibition of JNK activity with AdSEK blocked stretch-induced IL-8 production. Measurement of stretch-induced IL-8 protein production in AdSEK-transfected cell supernatants (pg/ml, n - 4–6/group). Effects of transfection were controlled by using AdLacZ. Filled bars, cells transfected with AdLacZ; open bars, cells transfected with AdSEK. *P < 0.05 vs. static; {dagger}P < 0.05 vs. stretch with AdSEK.

 

JNK inhibition with JNK inhibitor II blocked stretch-induced IL-8 mRNA expression and IL-8 protein production. We also pretreated A549 cells with the now available specific pharmacological JNK inhibitor II (SP-600125) to support our findings with gene transfer of SEK-1 (KR) (2, 10). Northern blot analysis and IL-8 protein measurement showed that stretch markedly increased the levels of IL-8 mRNA and IL-8 protein, and these were significantly reduced by SP-600125 (Fig. 5). Thus inhibition of JNKs by two different techniques, viral gene transfer of dominant inhibitors and pharmacological inhibition, blocked stretch-induced IL-8 production. We concluded that stretch-induced IL-8 expression is dependent, at least in part, on the JNK pathway.



View larger version (16K):
[in this window]
[in a new window]
 
Fig. 5. Inhibition of JNK activity with JNK inhibitor II (SP-600125) blocked stretch-induced IL-8 mRNA expression and IL-8 production. A, top: static, nonstretched A549 cells and cells exposed to 15% cyclic strain for 30 min were treated with (+) or without (-) 5 µM JNK inhibitor II for 3 h. A, bottom: GAPDH levels as internal control. The data represent a typical experiment repeated 3 times with similar results. B: arbitrary units were expressed as the ratio of IL-8 mRNA to GAPDH as described in MATERIALS AND METHODS. C: stretch-induced IL-8 protein production (pg/ml) in cell supernatants (n - 4/group). Data represent means ± SE of 3 independent experiments. *P < 0.05 vs. static, nonstretched cells; {dagger}P < 0.05 vs. stretch with JNK inhibitor.

 

Effects of JNK inhibitor II on the phosphorylation of p38, ERK1/2, and protein expression of NIK. We pretreated A549 cells with JNK inhibitor II and performed Western blot analyses to measure the effect of this inhibitor on the activation of p38, ERK, and NIK. No statistically significant inhibition of p38, ERK phosphorylation, and NIK protein expression was found (Fig. 6).



View larger version (28K):
[in this window]
[in a new window]
 
Fig. 6. Effects of JNK inhibitor on p38, ERK1/2, and NIK. Static, nonstretched A549 cells and cells exposed to 15% cyclic strain for 5 min–2 h were treated with or without 5 µM JNK inhibitor II for 3 h. Western blot was performed with antibody that recognizes the phosphorylated p38 or ERK1/2 expressions (A and B, top) and antibody that recognizes total p38 or ERK1/2 protein expressions (A and B, middle) and arbitrary units (A and B, bottom) (representative of n - 3 experiments). C: Western blot using antibody that recognizes the autophosphorylated and activated NIK protein expression (top) and arbitrary units (bottom). Arbitrary units were expressed as relative phosphorylation or NIK protein expression as described in MATERIALS AND METHODS. *P < 0.05 vs. static, nonstretched cells.

 

Inhibition of ERK1/2 and p38. To test the potential role of the more transient activation of phospho-p38 and ERK1/2 in stretch-induced IL-8 production, we treated A549 cells with specific MAPK inhibitors: SB-203580 (p38 inhibitor) and PD-98059 (ERK1/2 inhibitor). Neither of them significantly prevented the stretch-induced IL-8 production (Fig. 7C).

NF-{kappa}B and AP-1 binding sites are required for stretch-induced increase in IL-8 promoter activity. To determine the relative contribution of specific elements within the IL-8 promoter, NF-{kappa}B, NF-IL-6, and AP-1, we transiently transfected A549 cells with wild-type IL-8 promoter-CAT constructs and wild-type IL-8 promoter plasmids with mutation of NF-{kappa}B, NF-IL-6, or AP-1 binding sites. NF-{kappa}B and AP-1 mutants, but not the NF-IL-6 mutant, significantly blocked cyclic stretch-induced increase in IL-8 promoter activity (Fig. 8). The result demonstrated that both NF-{kappa}B and AP-1 promoter elements are involved in stretch-induced IL-8 gene activation.



View larger version (24K):
[in this window]
[in a new window]
 
Fig. 8. NF-{kappa}B and activator protein (AP)-1 binding sites were required for cyclic stretch-induced increase in IL-8 promoter activity. A: cells were transfected with plasmid constructs with a chloramphenicol acetyl transferase (CAT) reporter containing either wild-type IL-8 promoter or site-specific mutations of the NF-{kappa}B and NF-IL-6 binding sites. B: cells were transfected with plasmid constructs with a CAT reporter containing either wild-type IL-8 promoter from nucleotides or site-specific mutations of the AP-1 binding sites. Relative values were normalized to {beta}-galactosidase activity as an internal control and were expressed as the fold increase ratio of CAT level in static cells with culture media only. Data represent means ± SE of 3 independent experiments in quadruplet. *P < 0.05, compared with static or mutants without stretch within each group of constructs.

 

Cyclic stretch increased DNA binding by NF-{kappa}B and AP-1 but not NF-IL-6. We performed EMSA to further identify the amplitudes and kinetics of stretch-induced nuclear protein-DNA complex formation. Stretch increased NF-{kappa}B and AP-1 binding to oligonucleotides with their respective promoter elements in a dose-dependent manner (Fig. 9). AP-1 was activated at 5 min of stretch and remained activated for up to 30 min. NF-{kappa}B was activated in a time-dependent manner from 10 to 30 min of stretch (Fig. 10). Competition with binding was done with a 100-fold molar excess of unlabeled NF-{kappa}B or AP-1 consensus oligonucleotide (cold oligonucleotide probe). There was no significant effect of stretch on the NF-IL-6 binding that appeared to be constitutive (Fig. 10). These data suggest that stretch activated NF-{kappa}B and AP-1 binding but not NF-IL-6 binding to the IL-8 promoter.



View larger version (43K):
[in this window]
[in a new window]
 
Fig. 9. Cyclic stretch caused a dose-dependent increase on AP-1 and NF-{kappa}B binding in A549 cells. Left: cells were treated with TNF-{alpha} (10 ng/ml) without (lane 1) or with (lane 2) excess unlabeled corresponding consensus oligonucleotide (cold oligonucleotide probe). Cells were treated with medium alone (static, lane 3), 2% strain (lane 4), or 15% strain (lane 5) and incubated with the labeled AP-1 (top) or NF-{kappa}B (bottom) oligonucleotide. Right: arbitrary units were expressed as increase of DNA-binding activity as described in MATERIALS AND METHODS. The data represent a typical experiment repeated 3 times with similar results. *P < 0.05 vs. static, nonstretched cells; {dagger}P < 0.05 vs. 2% strain.

 


View larger version (52K):
[in this window]
[in a new window]
 
Fig. 10. Cyclic stretch caused a time-dependent increase on AP-1 and NF-{kappa}B but not NF-IL-6 binding in A549 cells. Left: cells were treated with TNF-{alpha} (10 ng/ml) without (lane 1) or with (lane 2) excess unlabeled corresponding consensus oligonucleotide (cold oligonucleotide probe). Cells were treated with medium alone (static for indicated times, lanes 3–6) or stretch of 15% strain at indicated time periods (lanes 7–10) and incubated with the radioactive AP-1 (top), NF-{kappa}B (middle), or NF-IL-6 (bottom) oligonucleotides, respectively. Right: arbitrary units were expressed as increase of DNA-binding activity as described in MATERIALS AND METHODS. The data represent a typical experiment repeated 3 times with similar results. *P < 0.05 vs. static, nonstretched cells.

 

JNK inhibitor II blocked stretch-induced IL-8 DNA binding by AP-1 but not NF-{kappa}B. To determine which transcription factor is activated in the stretch-induced JNK pathway, we pretreated A549 cells with JNK inhibitor II (SP-600125) and performed EMSA. SP-600125 effectively inhibited AP-1 binding activity but had no effect on NF-{kappa}B binding activity (Fig. 11). These data suggest that AP-1 binding activity was regulated by the JNK pathway but that stretch-induced increase of NF-{kappa}B binding activity was via another mechanism.



View larger version (31K):
[in this window]
[in a new window]
 
Fig. 11. JNK inhibitor II (SP-600125) blocked stretch-induced AP-1 binding activity but not NF-{kappa}B binding activity in A549 cells. Left: cells were treated with TNF-{alpha} (10 ng/ml) without (lane 1) or with (lane 2) excess unlabeled corresponding consensus oligonucleotide (cold oligonucleotide probe). Cells were treated without or with 5 µM JNK inhibitor II (lanes 3 and 4, static cells; lanes 5 and 6, 15% strain) and incubated with the labeled AP-1 (top) or NF-{kappa}B (bottom) oligonucleotide. Right: arbitrary units were expressed as increase of DNA-binding activity as described in MATERIALS AND METHODS. The data represent a typical experiment repeated 3 times with similar results. *P < 0.05 vs. static, nonstretched cells; {dagger}P < 0.05 vs. stretch with JNK inhibitor.

 

GF-109203X reduced stretch-induced NIK expression. To explore the mechanism responsible for stretch-induced NF-{kappa}B binding to IL-8 DNA, we determined NIK protein expression. NIK has been found to be an autophosphorylated MAPK, and the protein expression of NIK correlates with increased NIK activity as measured by activity assay (20, 23). Expression of NIK was increased after 5 min of stretch and persisted for 30 min of stretch. The increased expression of NIK was reduced by GF-109203X (Fig. 12, A and B), a PKC inhibitor, which has previously been shown to inhibit NIK expression in a dose-dependent manner (25, 42). Inhibition of increased NIK expression reduced stretch-induced IL-8 mRNA expression and NF-{kappa}B activation but not AP-1 activation (Fig. 12, C and D). These data suggest that stretch-induced IL-8 mRNA is also regulated by NIK and NF-{kappa}B.



View larger version (21K):
[in this window]
[in a new window]
 
Fig. 12. PKC inhibitor (GF-109203X) reduced stretch-induced time-dependent increase in NIK activity, IL-8 mRNA expression, and NF-{kappa}B binding. A: time course of stretch-induced NIK expression for 5–30 min. Cells were treated with TNF-{alpha} (10 ng/ml) for 30 min or exposed to cyclic stretch of 15% strain for 5–30 min. Top: NIK protein expression; bottom: arbitrary units were expressed as NIK protein expression as described in MATERIALS AND METHODS. Data at bottom represent means ± SE of 4 independent experiments. B: PKC inhibitor reduced stretch-induced NIK expression. Static, nonstretched A549 cells or cells exposed to 15% cyclic strain for 30 min were treated with or without 5 µM PKC inhibitor for 3 h. Top: NIK protein expression; bottom: arbitrary units were expressed as NIK protein expression as described in MATERIALS AND METHODS. Data at bottom represent means ± SE of 4 independent experiments. Inhibition of NIK expression reduced stretch-induced IL-8 mRNA expression (C) and NF-{kappa}B but not AP-1 binding (D). A549 cells were treated as in B, and nuclear extracts were generated and analyzed by EMSA. Arbitrary units were expressed as the ratio of IL-8 mRNA to GAPDH or increase of DNA binding activity as described in MATERIALS AND METHODS. The data in C and D represent typical experiments repeated 3 times with similar results. *P < 0.05, compared with static, nonstretched cells; {dagger}P < 0.05, compared with stretch with PKC inhibitor.

 

Effects of PKC inhibitor on MAPK activation. We pretreated A549 cells with PKC inhibitor to test the effect of this inhibitor on the activation of JNKs, p38, and ERK1/2. Western blot analyses show that JNKs, p38, and ERK phosphorylation were not statistically significantly inhibited by PKC inhibitor (Fig. 13).



View larger version (22K):
[in this window]
[in a new window]
 
Fig. 13. Effects of PKC inhibitor on the MAPK activation. Static, nonstretched A549 cells or cells exposed to 15% cyclic strain for 30 min were treated with or without 5 µM PKC inhibitor for 3 h. Western blot was performed using antibody that recognizes the phosphorylated JNKs, p38, or ERK1/2 expressions (top, A–C) and antibody that recognizes total JNKs, p38, or ERK1/2 protein expressions (middle, A–C) and arbitrary units (bottom, A–C) (representative of n - 3 experiments). Arbitrary units were expressed as relative phosphorylation as described in MATERIALS AND METHODS. *P < 0.05 vs. static, nonstretched cells.

 

NF-{kappa}B inhibitor SN-50 attenuated stretch-induced IL-8 production, IL-8 mRNA expression, and IL-8 DNA binding by AP-1 but not NF-{kappa}B. To explore the role of NF-{kappa}B in stretch-induced IL-8 regulation further, we treated A549 cells with a specific NF-{kappa}B inhibitor: SN-50 (21). Whereas the NF-{kappa}B inhibitor effectively inhibited NF-{kappa}B, but not AP-1, binding activity and IL-8 mRNA expression (Fig. 14, A and B), there was less inhibition (40%) of stretch-induced IL-8 protein secretion (Fig. 14C) compared with that of JNK inhibitor II (77%).



View larger version (21K):
[in this window]
[in a new window]
 
Fig. 14. NF-{kappa}B inhibitor (SN-50) reduced stretch-induced NF-{kappa}B binding activity, IL-8 mRNA expression, and IL-8 production. A: cells treated with TNF (10 ng/ml) without (lane 1) or with (lane 2) excess unlabeled NF-{kappa}B (top) or AP-1 (bottom) oligonucleotide competitor (cold oligonucleotide probe), static cells treated without (lane 3) or with 50 µg/ml of NF-{kappa}B inhibitor (lane 4) for 30 min, and cells treated with a 15% strain without (lane 5) or with NF-{kappa}B inhibitor (lane 6) were incubated with the labeled NF-{kappa}B(top) or AP-1 (bottom) oligonucleotide (representative on n - 3 experiments). B: IL-8 mRNA expression and GAPDH as internal control (representative of n - 3 experiments) from static, nonstretched cells and cells exposed to 15% cyclic strain with or without NF-{kappa}B inhibitor. Arbitrary units were expressed as increase of DNA-binding activity or the ratio of IL-8 mRNA to GAPDH as described in MATERIALS AND METHODS. C: IL-8 protein (pg/ml) in supernatants of static, nonstretched cells and cells exposed to 15% cyclic strain with or without NF-{kappa}B inhibitor (n - 4/group). *P < 0.05, compared with static, nonstretched cells; {dagger}P < 0.05, compared with stretch with NF-{kappa}B inhibitor.

 


    DISCUSSION
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Large tidal volumes in patients with ARDS lead to increased levels of IL-8 in bronchoalveolar lavage fluid (33). Animal studies have shown that simply overdistending lung tissue, in the absence of any other stimuli, causes production of cytokines and chemokines, but the mechanisms are unclear (8).

This is due to several factors. First, the reported pattern of stretch-induced MAPK activation differs depending on the cell type (14, 18, 22, 30, 36). In some cells, stretch induces activation of all three MAPKs, whereas in others, only a subset is activated. In addition, the regulation of IL-8 by MAPKs has differed depending on the stimulus (37) and the cell type (11, 19, 30). With stretch as the stimulus, Oudin and Pugin (30) found in BEAS-2B cells, an SV40-transformed bronchial epithelial cell line, that JNK, p38, and ERK1/2 were activated by stretch, and p38 and ERK1/2 were important in stretch-induced IL-8 production. However, studies in vivo with high tidal volume ventilation in rats found that JNK and ERK1/2 are activated, but p38 is not (43). Furthermore, in isolated rat lungs, inhibition of ERK1/2 with PD-98059 did not affect lung stretch-induced cytokine production (43). Consistent with these observations in vivo, we found that stretch-induced IL-8 production is not dependent on p38 and ERK1/2, rather we found that IL-8 is dependent on JNKs.

The biological roles of JNKs have been extremely difficult to characterize due to lack of specific pharmacological inhibitors. Although several investigators (30, 43) have found stretch-induced activation of JNK, the role of JNKs has not been defined. We employed two different strategies to determine whether stretch-induced IL-8 production was dependent on JNK, adenoviral gene transfer of SEK-1 (KR), the dominant-negative mutant of SEK1, an MEK immediately upstream of the JNKs that specifically inhibits the JNK pathway (6), and the recently available specific anthrapyrazolone inhibitor of JNK inhibitor II. Adenoviral transfection alone has been reported to induce IL-8 production (3). To control for the effects of adenoviral infection, we used AdLacZ. Infection was performed 48 h before stretch, and immediately before stretch, medium was changed to remove any adenovirus-induced IL-8 in cell supernatants. IL-8 production was higher in static cells with adenoviral transfection compared with noninfected cells, but we were able to induce further increases in IL-8 production with stretch. SEK-1 (KR) blocked this increase. We confirmed our findings with JNK inhibitor II, a small-molecule, ATP-competitive inhibitor with a >20-fold selectivity for JNKs (IC50 - 0.11–0.15 µM) over ERK2 and p38 (IC50 > 30 µM) when tested in cell culture (2, 10). These data are the first of which we are aware to directly implicate JNKs in the stretch-induced regulation of IL-8 gene expression.

Although JNK inhibition statistically blocked IL-8 production by SP-600125, we also explored other possible mechanisms. We found stretch induced expression of NIK, an ERK-related kinase, which has been shown to regulate NF-{kappa}B activation in a time-dependent and dose-dependent manner (20, 23). In our study, we also have shown stretch induced NIK expression in a dose- and time-dependent manner (Figs. 2B and 12A). Although specific pharmacological inhibitors for NIK were not available, we used GF-109203X, a PKC inhibitor, which has been shown to inhibit NIK (25) with minimal effects on MEKK1, JNK, p38, and ERK (Ref. 7 and Fig. 13). GF-109203X inhibited stretch-induced NIK expression but only partially blocked IL-8 mRNA expression and IL-8 protein production. Yamamoto and associates (45) also found that PKC inhibitors blocked stretch-induced IL-8 production in A549 cells, but they did not measure NIK expression. Thus stretch-induced IL-8 production also appears to involve NIK activation that may be PKC dependent.

Transcriptional regulation of the IL-8 promoter involved the interaction of NF-{kappa}B, AP-1, and/or NF-IL-6, depending on the cell type (30, 43) and stimuli employed (1, 1517, 24, 27, 29, 44). Cyclic stretch-induced activation of NF-{kappa}B has been found in isolated perfused mouse lungs (12) and rat lungs (43) and macrophages (31). Oudin and Pugin (30), employing SV40-transformed bronchial epithelial cells, found stretch induced activation of AP-1 but not NF-{kappa}B after 4 h of stretch. In contrast, our data suggest that both AP-1 and NF-{kappa}B were activated, and both were involved in stretch-induced IL-8 production. The NF-IL-6 binding site was not essential to stretch-induced IL-8 gene regulation, in that mutation of the NF-IL-6 binding site had no significant effect on stretch-induced IL-8 reporter activity (Fig. 8).

Others have found that stretch activated NF-{kappa}B and that this was blocked by a nonspecific inhibitor, dexamethasone (12, 31). To confirm the role of NF-{kappa}Binthe stretch-induced IL-8 production, we used a relatively specific NF-{kappa}B inhibitor (SN-50) (21) and found inhibition of NF-{kappa}B activity, IL-8 production, and IL-8 mRNA expression.

To identify the cell types involved in lung stretch-induced activation of MAPKs, Uhlig et al. (43) used immunohistochemical staining of rat lung tissue and found activation of JNK and ERK1/2 in type II pneumocytes. Insufficient numbers of type II pneumocytes could be freshly isolated to form confluent cell layers in our stretcher. Therefore, we selected human alveolar epithelial A549 cells for study, because they maintain features of type II pneumocytes through their morphological appearance and ability to secrete a variety of cytokines and growth factors, including monocyte chemotactic protein-1, IL-8, and intercellular adhesion molecule-1 (39).

In both humans and animals, lung stretch has been shown to be associated with release of chemokines. We have found that in an in vitro model of lung cell stretch, transcription regulation of IL-8 gene involved the action of at least two different signal transduction pathways, JNK/AP-1 and NIK/NF-{kappa}B, but only the JNK pathway appeared necessary for stretch-induced IL-8 production.


    ACKNOWLEDGMENTS
 
We thank Kathie Sweeney Laing for help in preparation of the manuscript.

DISCLOSURES

This work was supported by National Heart, Lung, and Blood Institute Grants HL-039020, HL-61688, and HL-67371.

We thank Susannah Wood for generous financial support.


    FOOTNOTES
 

Address for reprint requests and other correspondence: D. A. Quinn, Mass. General Hospital, Pulmonary and Critical Care Unit, 55 Fruit St., Bulfinch 148, Boston, MA 02114.

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. The Acute Respiratory Distress Syndrome Network. Ventilation with lower tidal volumes as compared with traditional tidal volumes for acute lung injury and the acute respiratory distress syndrome. N Engl J Med 342: 1301–1308, 2000.[Abstract/Free Full Text]
  2. Aihara M, Tsuchimoto D, Takizawa H, Azuma A, Wakebe H, Ohmoto Y, Imagawa K, Kikuchi M, Mukaida N, and Matsushima K. Mechanisms involved in Helicobactor pylori-induced interleukin-8 production by a gastric cancer cell line, MKN45. Infect Immun 65: 3218–3224, 1997.[Abstract]
  3. Bennet BL, Sasaki DT, Murray BW, O'Leary EC, Sakata ST, Xu W, Leisten JC, Motiwala A, Pierce S, Satoh Y, Bhagwat SS, Manning AM, and Anderson DW. SP600125, an anthrapyrazolone inhibitor of Jun N-terminal kinase. Proc Natl Acad Sci USA 98: 13681–13686, 2001.[Abstract/Free Full Text]
  4. Bruder JT and Kovesdi I. Adenovirus infection stimulates the Raf/MAPK signaling pathway and induces interleukin-8 expression. J Virol 71: 398–404, 1997.[Abstract]
  5. Bruhn KW, Nelms K, Boulay JL, Paul WE, and Lenardo MJ. Molecular dissection of the mouse interleukin-4 promoter. Proc Natl Acad Sci USA 90: 9707–9711, 1993.[Abstract/Free Full Text]
  6. Chirgwin JM, Przybyla AE, MacDonald RJ, and Rutter WJ. Isolation of biologically active ribonucleic acid from sources rich in ribonuclease. Biochemistry 18: 5294–5299, 1979.[Medline]
  7. Choukroun G, Hajjar R, Fry S, del Monte F, Haq S, Guerrero JL, Picard M, Rosenzweig A, and Force T. Regulation of cardiac hypertrophy in vivo by the stress-activated protein kinases/c-Jun NH2-terminal kinases. J Clin Invest 104: 391–398, 1999.[ISI][Medline]
  8. Davies SP, Reddy H, Caivano M, and Cohen P. Specificity and mechanism of action of some commonly used protein kinase inhibitors. Biochem J 351: 95–105, 2000.[ISI][Medline]
  9. Dreyfuss D and Saumon G. Ventilator-induced lung injury: lessons from experimental studies. Am J Respir Crit Care Med 157: 294–323, 1998.[Free Full Text]
  10. Force T, Pombo CM, Avruch JA, Bonventre JV, and Kyriakis JM. Stress activated protein kinases in cardiovascular diseases. Circ Res 78: 947–953, 1996.[Free Full Text]
  11. Han Z, Boyle DL, Chang L, Bennett B, Karin M, Yang L, Manning AM, and Firestein GS. c-Jun N-terminal kinase is required for metalloproteinase expression and joint destruction in inflammatory arthritis. J Clin Invest 108: 73–81, 2001.[ISI][Medline]
  12. Hashimoto S, Matsumoto K, Gon Y, Maruoka S, Takeshita I, Hayashi S, Koura T, Kujime K, and Horie T. p38 Mitogen-activated protein kinase regulates IL-8 expression in human pulmonary vascular endothelial cells. Eur Respir J 13: 1357–1364, 1999.[Abstract]
  13. Held HD, Boettcher S, Hamann L, and Uhlig S. Ventilation-induced chemokine and cytokine release is associated with activation of nuclear factor-{kappa}B and is blocked by steroids. Am J Respir Crit Care Med 163: 711–716, 2001.[Abstract/Free Full Text]
  14. Holtmann H, Winzen R, Holland P, Eickemeier S, Hoffmann E, Wallach D, Malinin NL, Cooper JA, Resch K, and Kracht M. Induction of interleukin-8 synthesis integrates effects on transcription and mRNA degradation from at least three different cytokine- or stress-activated signal transduction pathways. Mol Cell Biol 19: 6742–6753, 1999.[Abstract/Free Full Text]
  15. Ingram AJ, Ly H, Thai K, Kang M, and Scholey JW. Activation of mesangial cell signaling cascades in response to mechanical strain. Kidney Int 55: 476–485, 1999.[ISI][Medline]
  16. Krause A, Holtmann H, Eickemeier S, Winzen R, Szamel M, Resch K, Saklatvala J, and Kracht M. Stress-activated protein kinase/Jun N-terminal kinase is required for interleukin (IL)-1-induced IL-6 and IL-8 gene expression in the human epidermal carcinoma cell line KB. J Biol Chem 273: 23681–23689, 1998.[Abstract/Free Full Text]
  17. Kunsch C, Lang RK, Rosen CA, and Shannon MF. Synergistic transcriptional activation of the IL-8 gene by NF-kB p65 (RelA) and NF-IL-6. J Immunol 153: 153–164, 1994.[Abstract]
  18. Lee LF, Haskill JS, Mukaida N, Matsushima K, and Ting JPY. Identification of tumor-specific paclitaxel (Taxol)-responsive regulatory elements in the interleukin-8 promoter. Mol Cell Biol 17: 5097–5105, 1997.[Abstract]
  19. Li C, Hu Y, Mayr M, and Xu Q. Cyclic strain stress-induced mitogen-activated protein kinase (MAPK) phosphatase 1 expression in vascular smooth muscle cells is regulated by Ras/Rac-MAPK pathways. J Biol Chem 274: 25273–25280, 1999.[Abstract/Free Full Text]
  20. Li J, Kartha S, Iasvovskaia S, Tan A, Bhat RK, Manaligod JM, Page K, Brasier AR, and Hershenson MB. Regulation of human airway epithelial cell IL-8 expression by MAP kinases. Am J Physiol Lung Cell Mol Physiol 283: L690–L699, 2002.[Abstract/Free Full Text]
  21. Lin X, Mu Y, Cunningham ET Jr, Marcu KB, Geleziunas R, and Greene WC. Molecular determinants of NF-{kappa}B-inducing kinase action. Mol Cell Biol 18: 5899–5907, 1998.[Abstract/Free Full Text]
  22. Lin YZ, Yao SY, Veach RA, Torgerson TR, and Hawiger J. Inhibition of nuclear translocation of transcription factor NF-{kappa}B by a synthetic peptide containing a cell membrane-permeable motif and nuclear localization sequence. J Biol Chem 270: 14255–14258, 1995.[Abstract/Free Full Text]
  23. MacKenna DA, Dolfi F, Vouri K, and Ruoslahti E. Extracellular signal-regulated kinase and c-Jun NH2-terminal kinase activation by mechanical stretch is integrin-dependent and matrix-specific in rat cardiac fibroblasts. J Clin Invest 101: 301–310, 1998.[ISI][Medline]
  24. Malinin NL, Boldin MP, Kovalenko AV, and Wallach D. MAP3K-related kinase involved in NF-{kappa}B induction by TNF, CD95 and IL-1. Nature 385: 540–544, 1997.[Medline]
  25. Mastronarde JG, Monick MM, Mukaida N, Matsushima K, and Hunninghake GW. Activator protein-1 is the preferred transcription factor for cooperative interaction with nuclear factor-{kappa}B in respiratory syncytial virus-induced interleukin-8 gene expression in airway epithelium. J Infect Dis 177: 1275–1281, 1998.[ISI][Medline]
  26. Matsumoto M, Yamada T, Yoshinaga SK, Boone T, Horan T, Fujita S, Li Y, and Mitani T. Essential role of NF-{kappa}B-inducing kinase in T cell activation through the TCR/CD3 pathway. J Immunol 169: 1151–1158, 2002.[Abstract/Free Full Text]
  27. Maunder RJ, Shuman WP, McHugh JW, Marglin SI, and Butler J. Preservation of normal lung regions in the adult respiratory distress syndrome. Analysis by computed tomography. JAMA 255: 2463–2465, 1986.[Abstract]
  28. Mukaida N, Mahe Y, and Matsushima K. Cooperative interaction of nuclear factor-{kappa}B- and cis-regulatory enhancer binding protein-like factor binding elements in activating the interleukin-8 gene by pro-inflammatory cytokines. J Biol Chem 265: 21128–21133, 1990.[Abstract/Free Full Text]
  29. Mukaida N, Okamoto SI, Ishikawa Y, and Matsushima K. Molecular mechanism of gene expression. J Leukoc Biol 56: 554–558, 1994.[Abstract]
  30. Murayama T, Ohara Y, Obuchi M, Khabar KSA, Higashi H, Mukaida N, and Matsushima K. Human cytomegalovirus induces interleukin-8 production by a human monocytic cell line, THP-1, through acting concurrently on AP-1- and NF-{kappa}B-binding sites of the IL-8 gene. J Virol 71: 5692–5695, 1997.[Abstract]
  31. Oudin S and Pugin J. Role of MAP kinase activation in interleukin-8 production by human BEAS-2B bronchial epithelial cells submitted to cyclic stretch. Am J Respir Cell Mol Biol 27: 107–114, 2002.[Abstract/Free Full Text]
  32. Pugin J, Dunn I, Jolliet P, Tassaux D, Magnenat JL, Nicod LP, and Chevrolet JC. Activation of human macrophages by mechanical ventilation in vitro. Am J Physiol Lung Cell Mol Physiol 275: L1040–L1050, 1998.[Abstract/Free Full Text]
  33. Quinn DA, Moufarrej RK, Volokhov A, and Hales CA. Interactions of lung stretch, hyperoxia, and MIP-2 production in ventilator-induced lung injury. J Appl Physiol 93: 517–525, 2002.[Abstract/Free Full Text]
  34. Ranieri VM, Suter PM, Tortorella C, DeTullio R, Dayer JM, Brienza A, Bruno F, and Slutsky AS. Effect of mechanical ventilation on inflammatory mediators in patients with acute respiratory distress syndrome. JAMA 282: 54–61, 1999.[Abstract/Free Full Text]
  35. Sánchez I, Hughes RT, Mayer BJ, Yee K, Woodgett JR, Avruch J, Kyriakis JM, and Zon LI. Role of SAPK/ERK kinase-1 in the stress-activated pathway regulating transcription factor c-Jun. Nature 372: 794–798, 1994.[Medline]
  36. Schaffer JL, Rizen M, L'Italien GJ, Benbrahim A, and Megerman J, Gerstenfeld LC, and Gray ML. Device for the application of a dynamic biaxially uniform and isotropic strain to a flexible cell culture membrane. J Orthop Res 12: 709–719, 1994.[ISI][Medline]
  37. Seko Y, Takhashi N, Tobe K, Kadowaki T, and Yazaki Y. Pulsatile stretch activates mitogen-activated protein kinase (MAPK) family members and focal adhesion kinase (p125FAK) in cultured rat cardiac myocytes. Biochem Biophys Res Commun 259: 8–14, 1999.[ISI][Medline]
  38. Shapiro L and Dinarello CA. Osmotic regulation of cytokine synthesis in vitro. Proc Natl Acad Sci USA 92: 12230–12234, 1995.[Abstract/Free Full Text]
  39. Sica A, Dorman L, Viggiano V, Cippitelli M, Ghosh P, Rice N, and Young HA. Interaction of NF-{kappa}B and NFAT with the interferon-{gamma} promoter. J Biol Chem 272: 30412–30420, 1997.[Abstract/Free Full Text]
  40. Standiford TJ, Kunkel SL, Basha MA, Chensue SW, Lynch JP III, Toews GB, Westwick J, and Strieter RM. Interleukin-8 gene expression by a pulmonary epithelial cell line. A model for cytokine networks in the lung. J Clin Invest 86: 1945–1953, 1990.[ISI][Medline]
  41. Tremblay L, Valenza F, Ribeiro SP, Li J, and Slutsky AS. Injurious ventilatory strategies increase cytokines and c-fos mRNA expression in an isolated rat lung model. J Clin Invest 99: 944–952, 1997.[ISI][Medline]
  42. Toullec D, Pianetti P, Coste H, Bellevergue P, Grand-Perret T, Ajakane M, Baudet V, Boissin P, Boursier E, Loriolle F, Duhamel L, Charon D, and Kirilovsky J. The bisindolylmaleimide GF 109203X is a potent and selective inhibitor of protein kinase C. J Biol Chem 266: 15771–15781, 1991.[Abstract/Free Full Text]
  43. Uhlig U, Haitsma JJ, Goldmann T, Poelma DL, Lachmann B, and Uhlig S. Ventilation-induced activation of the mitogen-activated protein kinase pathway. Eur Respir J 20: 946–956, 2002.[Abstract/Free Full Text]
  44. Wu GD, Lai EJ, Huang N, and Wen X. Oct-1 and CCAAT/enhancer-binding protein (C/EBP) bind to overlapping elements within the interleukin-8 promoter. The role of Oct-1 as a transcriptional repressor. J Biol Chem 272: 2396–2403, 1997.[Abstract/Free Full Text]
  45. Yamamoto H, Teramoto H, Uetani K, Igawa K, and Shimizu E. Stretch induces a growth factor in alveolar cells via protein kinase. Respir Physiol 127: 105–111, 2001.[ISI][Medline]



This article has been cited by other articles:


Home page
Am. J. Respir. Cell Mol. Bio.Home page
C. D. Ochoa, H. Baker, S. Hasak, R. Matyal, A. Salam, C. A. Hales, W. Hancock, and D. A. Quinn
Cyclic Stretch Affects Pulmonary Endothelial Cell Control of Pulmonary Smooth Muscle Cell Growth
Am. J. Respir. Cell Mol. Biol., July 1, 2008; 39(1): 105 - 112.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
C. R. Amura, K. S. Brodsky, B. Gitomer, K. McFann, G. Lazennec, M. T. Nichols, A. Jani, R. W. Schrier, and R. Brian Doctor
CXCR2 agonists in ADPKD liver cyst fluids promote cell proliferation
Am J Physiol Cell Physiol, March 1, 2008; 294(3): C786 - C796.
[Abstract] [Full Text] [PDF]


Home page
Eur Respir JHome page
A. Haegens, J. H. J. Vernooy, P. Heeringa, B. T. Mossman, and E. F. M. Wouters
Myeloperoxidase modulates lung epithelial responses to pro-inflammatory agents
Eur. Respir. J., February 1, 2008; 31(2): 252 - 260.
[Abstract] [Full Text]