|
|
||||||||
Departments of 1Pulmonary and Critical Care Medicine and 2Cell Biology, The Cleveland Clinic Foundation, Cleveland 44195-5038; and 3Department of Pediatric Medicine, University of Cincinnati College of Medicine, Cincinnati, Ohio 45267
Submitted 3 July 2003 ; accepted in final form 31 July 2003
| ABSTRACT |
|---|
|
|
|---|
II), mannose receptor, and macrophage colony-stimulating factor receptor (M-CSFR) are decreased in PAP alveolar macrophages. In vitro studies demonstrate that exogenous GMCSF treatment upregulated PU.1 and M-CSFR gene expression in PAP alveolar macrophages. Finally, in vivo studies showed that PAP patients treated with GM-CSF therapy have higher levels of PU.1 and M-CSFR expression in alveolar macrophages compared with healthy control and PAP patients before GM-CSF therapy. These observations suggest that PU.1 is critical in the terminal differentiation of human alveolar macrophages. PU-1; c-fms; alveolar proteinosis
The exact mechanism of how GM-CSF is related to lung homeostasis and surfactant catabolism is unknown. Inefficient surfactant catabolism by alveolar macrophages and type 2 bronchoalveolar epithelial cells is related to GM-CSF deficiency and lack of maturation and/or differentiation of monocyte/macrophage lineage (19). Data by Shibata et al. (14) indicate that the GM-CSF-deficient state in the GM-CSF knockout mouse is associated with decreased expression of the transcription factor PU.1. In these studies, the absence of PU.1 protein expression in the alveolar macrophage correlated with decreased maturation, differentiation, and surfactant catabolism (14). Correction of the GMCSF defect in vitro resulted in increased expression of PU.1 and upregulation of PU.1-dependent markers CD32, mannose receptor (MR), and macrophage colony-stimulating factor receptor (M-CSFR) (14). This resulted in improved surfactant catabolism, adherence, and maturation. Whether PU.1 plays a pivotal role in healthy human alveolar macrophages in vivo or in PAP has not been previously described.
We therefore hypothesize that GM-CSF exerts its regulatory effects in the human lung through the regulation of PU.1 analogous to those observations in the GM-CSF knockout mouse model (14, 19). The purpose of the current study is to investigate PU.1 expression in human alveolar macrophages in vitro and in vivo in the context of human PAP. We further propose that decreased PU.1 expression downregulates markers of maturation including M-CSFR. We believe that these studies will provide important information on the role of GM-CSF in healthy lung homeostasis as well as PAP.
| METHODS |
|---|
|
|
|---|
Bronchoalveolar lavage fluid. Bronchoalveolar lavage (BAL) was performed as previously described (18). Differential cell counts were obtained from cytospins stained with a modified Wright's stain. Mean viability of lavage cells was >95% as determined by trypan blue dye exclusion. For culture, BAL cells were plated into six-well plates with or without 100 ng/ml of human GM-CSF for 48 h in RPMI 1640 medium supplemented with 5% human blood type AB serum (Gemini, Calabasas, CA), L-glutamine, and antibiotics. The BAL cell pellet was used to determine lavage cell differentials, cell culture for M-CSF, and real-time PCR for PU.1, M-CSF, and M-CSFR using primers from Applied Biomedical Incorporated (ABI, Foster City, CA). We used 300,000 BAL macrophages in 24-well plates for 24-h basal secretion of M-CSF. The median differentials from PAP patient BAL cells (n = 17) were as follows: alveolar macrophages, 87%; lymphocytes, 7%; and polymorphonuclear cells (PMN), 6%. In healthy controls (n = 12), BAL cells consisted of alveolar macrophages, 96%; lymphocytes, 3%; and PMN, 1%.
Cytokine assays. Supernatants from BAL cell cultures from PAP patients and healthy volunteers were assayed for M-CSF (R&D Systems, Minneapolis, MN) by ELISA with the sensitivity of 31.2-1,000 pg/ml for M-CSF. Samples below the sensitivity were reported as the lowest value, and samples above the sensitivity were diluted to obtain a value within the assay range. The coefficient of variation was <10%. All assays were carried out in duplicate.
RNA purification and analysis. Total RNA was extracted from BAL cells by RNeasy protocol (Qiagen, Valencia, CA). Expression of mRNA was determined by real-time RT-PCR using the ABI Prism 7000 Detection System (TaqMan; Applied Biosystems, Foster City, CA) according to the manufacturer's instructions. RNA specimens were analyzed in duplicate with primer sets for a housekeeping gene (GAPDH) and PU.1, M-CSF, or M-CSFR (ABI). Threshold cycle values for genes of interest were normalized to GAPDH and used to calculate the relative quantity of mRNA expression in PAP (or GM-CSF-treated) samples relative to untreated or healthy control values. Data are expressed as fold difference in mRNA expression relative to control values.
Fluorescence-activated cell sorting analysis. Alveolar macrophages obtained from PAP patients (n = 4) and healthy controls (n = 6) were stained for CD14, human leukocyte antigen (HLA)-DR, and MR. Briefly, 3 x 105 BAL macrophages were stained with FITC-labeled CD14, HLA-DR, or phycoerythrin-labeled CD32 or MR (PharMingen, San Diego, CA) for 30 min in cold PBS. Cells were washed and fixed in 2% paraformaldehyde. Cells were analyzed on a BD FACscan Analyzer compared with isotype-specific background controls. Results are expressed as mean percent positive-staining alveolar macrophages for 10,000 events.
Electrophoretic mobility shift assay. For electrophoretic mobility shift assay, 10 µg of each of the whole cell extracts were incubated in binding buffer (8 mM HEPES, pH 7.0, 10% glycerol, 20 mM KCl, 4 mM MgCl2, and 1 mM sodium pyrophosphate) containing 1 µg of poly(dI-dC) and 40,000 cpm probe for 20 min at room temperature as previously described (9). Specificity of the probe was shown by incubating the extract with a 1,000-fold molar excess of cold oligonucleotide. Sequence of the PU.1 binding site is as follows: 5'GGGGGGGAAAAACAGGAAGGGGGGGG3' and 5'CCCCCCCTTTTTGTCCTTCCCCCCCC3'.
Statistics. Data were analyzed by one-way analysis of variance and Student's t-test using Prism software (Graph-Pad, San Diego, CA). Significance was defined as P = 0.05.
| RESULTS |
|---|
|
|
|---|
|
PAP alveolar macrophages have decreased expression of terminal differentiation markers CD32 and MR. GM-CSF knockout studies have suggested that PU.1 is essential for terminal differentiation (14, 19). So, to determine whether PU.1 expression may alter human alveolar macrophage maturation in PAP, we evaluated healthy control (n = 6) and PAP (n = 4) alveolar macrophages for CD32 (FC
IIR), MR, and CD14 as markers of terminal differentiation. We found that both CD32 (P = 0.007) and MR (P = 0.001) expression was decreased on PAP alveolar macrophages, whereas the surface expression of CD14 (P = 0.216) was not significantly different than controls (Fig. 2). HLA-DR staining of PAP alveolar macrophages, 83 ± 4%, was similar to healthy controls, 84 ± 6%.
|
BAL cells are not the primary source of the elevated levels of M-CSF in the BAL of PAP patients. BAL cells were obtained from healthy volunteers (n = 6) and PAP patients (n = 4) and evaluated for both M-CSF mRNA and protein secretion. BAL cell M-CSF mRNA expression was not different compared with healthy controls (P = 0.187). Similarly, PAP and healthy control BAL cell secretion of M-CSF protein (2,609 ± 219 pg/ml vs. 2,648 ± 633 pg/ml for PAP and healthy controls, respectively) was not different (P = 0.467, means ± SE).
M-CSFR expression is deficient in PAP BAL cells. PU.1 regulates c-fms (M-CSFR) and may affect BAL cell response to the elevated M-CSF in PAP BAL fluid (2). We examined PAP (n = 6) and healthy control (n = 6) BAL cells for expression of M-CSFR by real-time PCR and found that M-CSFR mRNA was deficient in PAP compared with healthy controls (Fig. 3, P = 0.003).
|
GM-CSF increases PU.1 expression in vitro. Because PAP is an anti-GM-CSF autoimmune disease and GMCSF can regulate PU.1 expression in the GM-CSF knockout mouse, we evaluated the effect of GM-CSF on PAP and healthy control BAL cells in vitro. Cultured BAL cells were rested for 24 h and were then incubated in the presence of GM-CSF for an additional 48 h. Healthy control BAL cells, as anticipated, did not have a significant increase in PU.1 mRNA expression relative to cells cultured in the absence of GM-CSF [1.6 ± 0.1-fold, n = 2, P > 0.05 (not significant)]; PU.1 is constitutively expressed at high levels in control BAL (14). In contrast, PAP cells cultured with GM-CSF had a significant increase in PU.1 mRNA (2.3 ± 0.6-fold, n = 2, P = 0.02). Furthermore, GM-CSF treatment of healthy control and PAP alveolar macrophages resulted in an increase in M-CSFR mRNA (healthy control: 9.6 ± 1.6-fold, n = 2, P = 0.01; PAP: 2.4 ± 0.6-fold, n = 2, P = 0.03).
GM-CSF therapy in PAP patients increases PU.1 protein expression. We evaluated PAP patients in a preliminary pilot study of GM-CSF therapy for changes in PU.1 binding activity. Before GM-CSF therapy, PAP patients (Fig. 4) have deficient PU.1 binding activity compared with healthy controls. Patients on GM-CSF therapy showed levels of PU.1 activity similar to healthy controls. This suggests that the deficient PU.1 activity in PAP patients is corrected by the GMCSF therapy.
|
GM-CSF therapy enhances PU.1 and M-CSFR expression in PAP patients. Both PU.1 (Fig. 5A) and M-CSFR (Fig. 5B) mRNA is decreased in PAP patients (n = 6) compared with healthy controls (n = 6). BAL cells from patients on therapy (n = 5) demonstrated increased PU.1 (P = 0.03) and M-CSFR (P = 0.01) expression compared with baseline.
|
| DISCUSSION |
|---|
|
|
|---|
II), MR, and M-CSFR were also decreased. In vitro studies demonstrated that GM-CSF treatment upregulates PU.1 and M-CSFR gene expression in alveolar macrophages from PAP patients. Finally, PAP patients treated with GM-CSF therapy have higher levels of PU.1 and M-CSFR expression in alveolar macrophages ex vivo compared with healthy control and PAP patients before GM-CSF treatment. These observations suggest that PU.1 is critical in the terminal differentiation of alveolar macrophages. GM-CSF promotes monocytic and granulocytic progenitor cell growth, differentiation, and activation (3, 15). GM-CSF activates PU.1, which in turn interacts with transcription binding sites in gene expression differentiation markers such as CD32, MR, and MCSFR. This results in a complex series of reactions within the myeloid progenitor, which ultimately leads to terminal differentiation and the upregulation of these maturation markers (8, 19). Together with data from the GM-CSF knockout mouse model (14), data presented here with the rare PAP lung disease indicate that GM-CSF acts through PU.1 as a regulator of human alveolar macrophages both in vitro and ex vivo.
M-CSF shares important and overlapping properties with GM-CSF related to monocyte/macrophage differentiation (4). M-CSF levels are elevated in the lungs of both the murine GM-CSF knockout model of PAP as well as patients with PAP. Data from our study indicate that M-CSFR expression, which is regulated by PU.1, is markedly reduced in PAP compared with healthy controls and can be upregulated by GM-CSF. The lack of M-CSFR expression may prevent and/or decrease alveolar macrophage response to the elevated BAL M-CSF, which may be generated by a compensatory response to the lack of biologically active GM-CSF in both human and mouse PAP (2, 14). The source of enhanced M-CSF levels in BAL remains unknown. M-CSF gene expression and protein secretion did not differ between BAL cells from healthy controls and PAP patients.
PU.1 knockout mice do not produce lymphoid or myeloid cells and die before or shortly after birth (5, 8), whereas GM-CSF knockout mice are deficient in PU.1 protein and survive until the development of an alveolar proteinosis syndrome in the lung (14, 19). In the GM-CSF knockout mouse model, GM-CSF expression is absent throughout development, whereas in human PAP, GM-CSF is present but is neutralized by circulating levels of anti-GM-CSF, which appears most commonly in the second or third decade of life (12). We have shown here that BAL cells from PAP patients demonstrate a modest but significant decrease in PU.1, consistent with the GM-CSF knockout mouse. These results suggest that GM-CSF is important in the regulation of PU.1 expression in alveolar macrophages in the lung. The implication is that GM-CSF is required for healthy lung homeostasis through the regulation of PU.1 and myeloid terminal differentiation.
In summary, we demonstrate decreased PU.1 gene expression and activity in PAP BAL cells. Furthermore, expression of the PU.1-regulated differentiation-associated cell surface markers MR and CD32, as well as M-CSFR gene expression, are decreased. The addition of exogenous GM-CSF to alveolar macrophages in vitro and in vivo enhances the expression of PU.1 and M-CSFR. These findings support the critical role of GM-CSF in human lung homeostasis.
| DISCLOSURES |
|---|
|
|
|---|
We are also grateful for the generous support of Regina Taussig.
| FOOTNOTES |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
| REFERENCES |
|---|
|
|
|---|
B activation in alveolar macrophages. Am J Respir Cell Mol Biol 21: 311-316, 1999.This article has been cited by other articles:
![]() |
P. C. Joshi, R. Raynor, X. Fan, and D. M. Guidot HIV-1-Transgene Expression in Rats Decreases Alveolar Macrophage Zinc Levels and Phagocytosis Am. J. Respir. Cell Mol. Biol., August 1, 2008; 39(2): 218 - 226. [Abstract] [Full Text] [PDF] |
||||
![]() |
B G G Oliver, S Lim, P Wark, V Laza-Stanca, N King, J L Black, J K Burgess, M Roth, and S L Johnston Rhinovirus exposure impairs immune responses to bacterial products in human alveolar macrophages Thorax, June 1, 2008; 63(6): 519 - 525. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. A. Frazier, T. J. Franks, E. O. Cooke, T.-L. H. Mohammed, R. D. Pugatch, and J. R. Galvin From the Archives of the AFIP: Pulmonary Alveolar Proteinosis RadioGraphics, May 1, 2008; 28(3): 883 - 899. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Inoue, B. C. Trapnell, R. Tazawa, T. Arai, T. Takada, N. Hizawa, Y. Kasahara, K. Tatsumi, M. Hojo, T. Ichiwata, et al. Characteristics of a Large Cohort of Patients with Autoimmune Pulmonary Alveolar Proteinosis in Japan Am. J. Respir. Crit. Care Med., April 1, 2008; 177(7): 752 - 762. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. L. Koth, B. Alex, S. Hawgood, M. A. Nead, D. Sheppard, D. J. Erle, and D. G. Morris Integrin beta6 Mediates Phospholipid and Collectin Homeostasis by Activation of Latent TGF-beta1 Am. J. Respir. Cell Mol. Biol., December 1, 2007; 37(6): 651 - 659. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. M. Rotoli, V. Dall'Asta, A. Barilli, R. D'Ippolito, A. Tipa, D. Olivieri, G. C. Gazzola, and O. Bussolati Alveolar Macrophages from Normal Subjects Lack the NOS-Related System y+ for Arginine Transport Am. J. Respir. Cell Mol. Biol., July 1, 2007; 37(1): 105 - 112. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Uchida, D. C. Beck, T. Yamamoto, P.-Y. Berclaz, S. Abe, M. K. Staudt, B. C. Carey, M.-D. Filippi, S. E. Wert, L. A. Denson, et al. GM-CSF Autoantibodies and Neutrophil Dysfunction in Pulmonary Alveolar Proteinosis N. Engl. J. Med., February 8, 2007; 356(6): 567 - 579. [Abstract] [Full Text] [PDF] |
||||
![]() |
P.-Y. Berclaz, B. Carey, M.-D. Fillipi, K. Wernke-Dollries, N. Geraci, S. Cush, T. Richardson, J. Kitzmiller, M. O'Connor, C. Hermoyian, et al. GM-CSF Regulates a PU.1-Dependent Transcriptional Program Determining the Pulmonary Response to LPS Am. J. Respir. Cell Mol. Biol., January 1, 2007; 36(1): 114 - 121. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. C. Joshi, L. Applewhite, P. O. Mitchell, K. Fernainy, J. Roman, D. C. Eaton, and D. M. Guidot GM-CSF receptor expression and signaling is decreased in lungs of ethanol-fed rats Am J Physiol Lung Cell Mol Physiol, December 1, 2006; 291(6): L1150 - L1158. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. B. Venkateshiah, T. D. Yan, T. L. Bonfield, M. J. Thomassen, M. Meziane, C. Czich, and M. S. Kavuru An open-label trial of granulocyte macrophage colony stimulating factor therapy for moderate symptomatic pulmonary alveolar proteinosis. Chest, July 1, 2006; 130(1): 227 - 237. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. McAllister, C. Steele, M. Zheng, J. E. Shellito, and J. K. Kolls In Vitro Effector Activity of Pneumocystis murina-Specific T-Cytotoxic-1 CD8+ T Cells: Role of Granulocyte-Macrophage Colony-Stimulating Factor Infect. Immun., November 1, 2005; 73(11): 7450 - 7457. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Tazawa, E. Hamano, T. Arai, H. Ohta, O. Ishimoto, K. Uchida, M. Watanabe, J. Saito, M. Takeshita, Y. Hirabayashi, et al. Granulocyte-Macrophage Colony-Stimulating Factor and Lung Immunity in Pulmonary Alveolar Proteinosis Am. J. Respir. Crit. Care Med., May 15, 2005; 171(10): 1142 - 1149. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Ochs, L. Knudsen, L. Allen, A. Stumbaugh, S. Levitt, J. R. Nyengaard, and S. Hawgood GM-CSF mediates alveolar epithelial type II cell changes, but not emphysema-like pathology, in SP-D-deficient mice Am J Physiol Lung Cell Mol Physiol, December 1, 2004; 287(6): L1333 - L1341. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |