|
|
||||||||
and tissue injury are dependent on NF-
B p50
Department of Pharmacology and Toxicology, Rutgers University; and Department of Environmental and Occupational Medicine, University of Medicine and Dentistry of New Jersey-Robert Wood Johnson Medical School, Piscataway, New Jersey 08854
Submitted 29 September 2003 ; accepted in final form 18 March 2004
| ABSTRACT |
|---|
|
|
|---|
, which have been implicated in the pathogenic process. Generation of these mediators is regulated in part by transcription factors, e.g., NF-
B and CCAAT/enhancer-binding protein (C/EBP). The present studies used NF-
B p50 knockout mice to assess the role of this transcription factor protein in ozone-induced inflammatory mediator production and toxicity. Treatment of wild-type (WT) mice with ozone (0.8 ppm, 3 h) resulted in a rapid increase in NF-
B binding activity in alveolar macrophages that peaked after 612 h. This response was attenuated in NF-
B p50/ mice. In WT mice, but not NF-
B p50/ mice, C/EBP was also markedly increased in macrophages following ozone inhalation. Ozone also induced changes in the mobility of C/EBP in gel shift assays, suggesting alterations in the transcription factor complex that may be important in controlling inflammatory gene expression. Whereas macrophages from WT mice produced increased quantities of nitric oxide and TNF-
following ozone inhalation, this was not observed in cells from NF-
B p50/ mice. Ozone-induced decreases in expression of the anti-inflammatory cytokine IL-10 were also prevented in NF-
B p50/ mice. In WT mice, ozone inhalation caused an increase in bronchoalveolar lavage protein, a marker of tissue damage. This was not evident in NF-
B p50/ mice. There was also no evidence of peroxynitrite-mediated lung injury in these mice. These findings demonstrate that NF-
B and possibly C/EBP signaling are important in ozone-induced production of reactive nitrogen intermediates and TNF-
and in tissue injury.
ozone; nuclear factor-
B; interleukin-10; CCAAT/enhancer-binding protein
) play an important role in nonspecific host defense. However, under pathophysiological states, excessive production of these mediators can lead to tissue injury (16). The promoter regions of the genes for NOS II and TNF-
contain consensus sequences for a number of different transcription factors that regulate their activity (15, 20). Of particular interest is nuclear factor kappa B (NF-
B), a ubiquitous transcription factor activated by proinflammatory stimuli such as bacteria-derived lipopolysaccharide (LPS), TNF-
, interleukin-1 (IL-1), and heat shock protein 60 (19). In resting cells, NF-
B is complexed to inhibitory protein kappa B (I
B), which retains it in the cytoplasm in an inactive form. Stimulation of cells with proinflammatory mediators leads to I
B phosphorylation and subsequent proteosome-mediated degradation. This process releases NF-
B, which translocates to the nucleus and binds to regulatory elements on responsive genes (19).
Acute inhalation of the pulmonary irritant ozone results in activation of macrophages to release increased quantities of TNF-
and nitric oxide, as well as peroxynitrite (5, 6, 2224). Ozone inhalation is also associated with increased expression of cyclooxygenase-2 (COX-2) and production of prostaglandin E2 (6). Each of these mediators has been implicated in ozone-induced toxicity (16). The present studies were focused on analyzing potential biochemical mechanisms regulating production of inflammatory mediators in the lung following ozone inhalation. The results of our studies demonstrate that the p50 subunit of NF-
B plays a critical role in excessive production of TNF-
and nitric oxide and in lung injury in this model.
| MATERIALS AND METHODS |
|---|
|
|
|---|
B p50/ mice (30) were obtained from Bristol-Myers Squibb (Princeton, NJ). Wild-type B6J129SV F2 mice were from Jackson Laboratories (Bar Harbor, ME). Animals were housed in microisolator cages and received food and sterile pathogen-free water ad libitum. Animals were placed in whole body Plexiglas chambers and exposed to ultrapure air (control) or 0.8 ppm ozone for 3 h. Ozone was generated from oxygen gas via an ultraviolet light ozone generator (Orec, Phoenix, AZ). Ozone concentrations in the chamber were maintained by adjusting both the intensity of the ultraviolet light (mJ/cm2) and the flow rate (ml/min). Concentrations of ozone (in ppm) were continuously monitored with an ozone analyzer (model 1008 AH; Dasibi Environmental, Glendale, CA). All animals received humane care in compliance with the institution's guidelines, as outlined in the Guide for the Care and Use of Laboratory Animals published by the National Institutes of Health. Animal use was approved by the Rutgers University Institutional Animal Care and Use Committee.
Reagents.
Mouse recombinant interferon-gamma (IFN-
) was purchased from GIBCO (Grand Island, NY). Salmonella enteritidis LPS and DNase I were obtained from Sigma Chemical (St. Louis, MO). Rabbit polyclonal anti-NOS II (sc-650) and anti-interleukin-10 (IL-10) (sc-1783) antibodies, goat polyclonal anti-COX-2 (sc-1747), and anti-TNF-
(sc-780) antibodies and horseradish peroxidase (HRP)-conjugated anti-rabbit and anti-goat IgG were from Santa Cruz Biotechnology (Santa Cruz, CA). Rabbit polyclonal antibody against nitrotyrosine was from Upstate Biotechnology (Lake Placid, NY), and rabbit polyclonal antibodies against NF-
B p50 and p65 were from Stressgen (Victoria, BC, Canada).
Cell isolation and preparation of extracts. Alveolar macrophages were isolated from the lung as previously described (6). Briefly, mice were anesthetized, the lung was excised, and the trachea and major bronchi were removed. The lung was then cut into uniform 500-µm slices (MacIlwain tissue chopper; Brinkmann Instruments, Westbury, NY) and incubated in ice-cold Ca2+/Mg2+-free Hanks' balanced salt solution (HBSS) containing 0.005% DNase I (HBSS-DNase) for 30 min. This was followed by mixing with a Vortex Genie 2 (Fisher Scientific, Pittsburgh, PA) at speed 3. The cells released during these steps were filtered through a 220-µm filter, washed, and subjected to metrizamide gradient centrifugation with a Beckman TJ-6 centrifuge for elimination of red blood cells, dead cells, and debris. Cell viability was >98% as assessed by trypan blue dye exclusion. Purity was >97% macrophages based on differential staining with Giemsa (Fisher Scientific, Springfield, NJ). To prepare extracts, we lysed cells in buffer (10 mM HEPES, pH 7.4, 10 mM KCl, 2 mM MgCl2, and 2 mM EDTA) on ice for 10 min with intermittent mixing for 2 s with a Vortex Genie at a setting of 3. Nonidet P-40 was added (final concentration 0.1%), and the cells were incubated for an additional 5 min on ice. Cells were then centrifuged at 4°C (16,000 g) using an Eppendorf microcentrifuge for 5 min, supernatants containing cytoplasmic extracts were collected, and aliquots were stored at 70°C. The pellet was resuspended in buffer (50 mM HEPES, pH 7.4, 50 mM KCl, 300 mM NaCl, 0.1 mM EDTA, and 10% glycerol). After 20 min on ice, the sample was centrifuged at 4°C (16,000 g) for 5 min, supernatants containing nuclear extracts were collected, and aliquots were stored at 70°C. Protein determinations were performed with a BCA protein assay kit (Pierce, Rockford, IL) with bovine serum albumin (BSA) as the standard. Unless otherwise specified, a Perkin-Elmer Lambda 3 UV/VIS absorbance spectrophotometer was used for protein determinations and all subsequent assays.
Quantitation of bronchoalveolar lavage protein. Animals were killed, and the trachea was cannulated with polyethylene tubing (PE-90; Clay Adams, Parsippany, NJ) attached to a 3-ml Becton-Dickinson (Franklin Lakes, NJ) single-use syringe. The lung was then instilled with 1 ml of Ca2+/Mg2+-free phosphate-buffered saline (PBS) at 37°C, and the fluids were slowly withdrawn and instilled three times. The lavage fluid was centrifuged (350 g for 10 min, 4°C), and protein content in supernatants was quantified by the Bradford protein assay (Bio-Rad Laboratories, Hercules, CA) with BSA as the standard.
Measurement of nitric oxide production.
Cells were cultured in 96-well dishes (2 x 105 cells/well) in phenol red-free Dulbecco's modified Eagle's medium in the presence or absence of LPS (100 ng/ml) and IFN-
(100 U/ml) or medium control. Nitric oxide was quantified after 48 h by the accumulation of nitrite in the culture medium by the Griess reaction with sodium nitrite as the standard as previously described (6, 22). For nitrate determinations, samples were treated with nitrate reductase and NADPH for 30 min before analysis. We found that the ratio of nitrate to nitrite produced by alveolar macrophages was 1:1 and that this ratio did not change in cells from ozone-treated mice.
Western blot analysis. Cytoplasmic extracts were run on 7.5% SDS-polyacrylamide gels (5 µg protein/lane) as described previously (5, 6). Proteins were then transferred to nitrocellulose and blocked overnight at 4°C with 5% powdered milk (5, 6). The nitrocellulose membrane was then incubated with a 1:200 dilution of anti-NOS II, anti-p50, or anti-COX-2 antibody for 3 h at room temperature followed by HRP-conjugated anti-rabbit or anti-goat IgG (1:5,000) for 1 h. The blots were developed with an enhanced chemiluminescence detection kit (Amersham Life Science, Arlington Heights, IL). Blots were stained with Ponceau S (Sigma) to confirm equal loading of proteins on the gels.
Electrophoretic mobility shift assay.
Electrophoretic mobility shift assays were performed as previously described by our laboratory (5). Binding reactions were carried out at room temperature for 30 min in a total volume of 15 µl and contained 25 µg of nuclear extract protein, 5 ml of the 5x gel shift binding buffer (20% glycerol, 5 mM MgCl2, 2.5 mM EDTA, 2.5 mM DTT, 250 mM NaCl, 50 mM Tris·HCl, pH 7.5), 2 µg poly(dI-dC), and 3 x 104 cpm/ml of
[32]P-labeled NF-
B (AGTTGAGGGTTTCCCAGGC) (Promega, Madison, WI) or CCAAT/enhancer-binding proteins (C/EBP) (TGCAGATTGCGCAATCTGCA) (Santa Cruz Biotechnology) consensus oligonucleotides. Probes were labeled with
[32]P-ATP (3,000 Ci/mmol; NEN, Boston, MA). Protein-DNA complexes were separated on 5% nondenaturing polyacrylamide gels run at 250 V at 400 mA for 1.5 h in running buffer containing 44 mM Tris base, 44 mM boric acid, and 2 mM EDTA, pH 8, and visualized after the gels were dried and autoradiographed. For supershift reactions, the samples were incubated with antibodies (1 µg) to NF-
B p50 or p65 on ice for 20 min before the labeled oligonucleotide. For competitor reactions, samples were preincubated with a 100-fold excess of the respective unlabeled oligonucleotides.
Immunostaining.
Tissue sections (6 µm) were prepared for immunohistochemistry from paraffin-embedded perfused lungs that were inflation-fixed with 3% paraformaldehyde for 4 h at 4°C (22, 24). Sections were deparaffinized before analysis. For immunostaining, slides were preincubated for 30 min in 3% hydrogen peroxide to quench endogenous peroxidase. This was followed by incubation for 20 min in PBS containing 1% BSA and 0.05% sodium azide and overnight incubation with rabbit antinitrotyrosine (1:2,000), rabbit anti-IL-10 (1:200), or goat anti-TNF-
(1:1,000) antibodies or with nonimmune rabbit or goat IgG. A Vectastain ABC kit (Vector Laboratories, Burlingame, CA) was utilized to visualize antibody binding. In some experiments the antinitrotyrosine antibody was incubated overnight with 2 mg/ml nitrotyrosine before use. This treatment was found to block nitrotyrosine staining, demonstrating that the antibody was specific.
Statistics.
All experiments were repeated three to five times using three to six animals per experiment. Data were analyzed by a nonpaired, two-tailed Student's t-test. A P value of
0.05 was considered statistically significant.
| RESULTS |
|---|
|
|
|---|
B nuclear binding activity.
In initial studies we analyzed the effects of ozone inhalation on NF-
B nuclear binding activity in alveolar macrophages. NF-
B binding activity was not detectable in cells from air-exposed animals (Fig. 1A). Treatment of the mice with ozone resulted in a time-related increase in NF-
B binding activity, which was observed immediately after exposure and peaked after 612 h. This was followed by a decrease at 24 h and then a secondary increase at 48 h. We blocked NF-
B nuclear binding activity by incubating the samples with 100-fold excess of unlabeled probe, demonstrating the specificity of the probe. Moreover, supershift assays using antibodies to p50 or p65 slowed the migration of the complex in the gel, indicating that both of these proteins were involved in the response. Increased NF-
B p50 protein expression was also observed in alveolar macrophages following ozone inhalation (Fig. 1B). This was greater in nuclear, compared with cytoplasmic, extracts. To analyze the role of NF-
B p50 in ozone-induced tissue injury and in inflammatory mediator production, we used transgenic mice with a targeted disruption of the gene for this protein. As expected, NF-
B p50 protein was not detectable in alveolar macrophages from NF-
B p50/ mice, even after ozone inhalation (Fig. 1). Moreover, only very low levels of NF-
B binding activity were evident in nuclear extracts of macrophages from p50/ mice exposed to ozone (Fig. 1).
|
B p50 on ozone-induced alterations in inflammatory mediator production.
We have previously demonstrated that alveolar macrophages are activated following ozone inhalation to release excessive quantities of inflammatory mediators (5, 6, 2224). In further studies we analyzed the effects of loss of NF-
B p50 on this response. Initially we quantified production of reactive nitrogen intermediates. Alveolar macrophages generate nitric oxide from L-arginine via the enzyme NOS II (11). Treatment of wild-type mice with ozone resulted in increased NOS II expression in the lung that was most prominent in alveolar macrophages (Fig. 2). After ozone inhalation, NOS II was also evident in type II cells. These findings are in accord with previous reports from our laboratory (25). Expression of NOS II was not observed in lungs of NF-
B p50/ mice treated with ozone. NOS II was also not detectable in the lungs of mice exposed to air control. To determine whether ozone-induced alterations in NOS II expression were correlated with changes in the activity of this enzyme, we quantified nitric oxide production by alveolar macrophages. Cells from wild-type mice readily generated nitric oxide after stimulation with LPS and IFN-
(Fig. 2, bottom). This response increased following ozone inhalation. In contrast, alveolar macrophages from NF-
B p50/ mice produced only low levels of nitric oxide, and this was unaltered by ozone. Nitric oxide reacts rapidly with superoxide anion, generating peroxynitrite, a potent oxidant known to nitrosylate tyrosine residues in cells and tissues (14). Consistent with our previous studies (6), we found significant nitrotyrosine staining of the lung of wild-type mice following ozone inhalation (Fig. 3). This was most prominent in alveolar macrophages. Nitrotyrosine staining was not detectable in lung sections from NF-
B p50/ mice. Nitrotyrosine staining was also not detectable in lung sections from air-exposed wild-type or NF-
B p50/ mice or in sections stained with IgG.
|
|
B p50 on ozone-induced expression of COX-2, which mediates the production of eicosanoids (31). Constitutive COX-2 protein was evident in alveolar macrophages from both wild-type and NF-
B p50/ mice (Fig. 4). This was observed in histological sections and isolated cells. Interestingly, alveolar macrophages from NF-
B p50/ mice expressed three- to fourfold greater quantities of COX-2 than cells from wild-type mice. Whereas expression of COX-2 increased approximately twofold in cells from wild-type mice after ozone inhalation, no significant changes were observed in cells from NF-
B p50/ mice.
|
. Significant TNF-
staining was observed in the lungs of wild-type mice following ozone inhalation (Fig. 5A). In contrast, there was no evidence of TNF-
expression in lung sections from air-treated wild-type or NF-
B p50/ animals. Moreover, ozone inhalation had no effect on TNF-
expression in NF-
B p50/ mice.
|
B p50/ mice. Relatively high levels of IL-10 were detectable in lung sections from air-exposed mice, most prominently in alveolar macrophages (Fig. 5B). Whereas ozone treatment resulted in decreased IL-10 expression in the lungs of the wild-type mice, this was not observed in NF-
B p50/ mice.
Effects of ozone on C/EBP nuclear binding activity.
In further studies we investigated the effects of ozone on nuclear binding of C/EBP, another family of transcription factors known to regulate the activity of inflammatory genes including NOS II and COX-2 (26). Low levels of C/EBP nuclear binding activity were detectable in alveolar macrophages from air-exposed mice (Fig. 6). Treatment of the mice with ozone resulted in a time-related increase in C/EBP binding activity that peaked 6 h postexposure. Subsequently, C/EBP activity returned to control levels. We also observed faster migration of the complex in the gels, which was most prominent in samples obtained from mice 36 h postozone exposure. C/EBP nuclear binding activity was blocked by incubating the samples with a 100-fold excess of unlabeled probe, demonstrating the specificity of the probe. Moreover, preincubation of nuclear extracts with anti-C/EBP antibody markedly reduced the migration of the complex in the gel. C/EBP binding activity was not evident in macrophages from NF-
B p50/ mice, even after ozone inhalation.
|
B p50 on ozone-induced epithelial injury.
Bronchoalveolar lavage protein content is a marker of alveolar epithelial injury (10). As reported previously (6), ozone inhalation resulted in a twofold increase in protein levels in bronchoalveolar lavage (Fig. 7). In contrast, bronchoalveolar lavage fluid protein levels were at control levels in NF-
B p50/ mice following ozone exposure.
|
| DISCUSSION |
|---|
|
|
|---|
, and eicosanoids by alveolar macrophages after ozone inhalation (5, 6, 2224). Moreover, inhibiting macrophages or the activity of these mediators prevented ozone-induced tissue damage, demonstrating their importance in toxicity (3, 5, 6, 23). The present studies focused on analyzing biochemical mechanisms regulating production of these mediators in the lung during ozone-induced toxicity. Our findings that alveolar macrophages from NF-
B p50/ mice did not generate increased quantities of TNF-
or reactive nitrogen intermediates after ozone inhalation and that these mice were protected from tissue damage demonstrate the importance of NF-
B signaling in this model of lung injury. A similar attenuation of inflammation and lung injury has been described in a model of allergen-induced asthma as well as inflammatory arthritis in NF-
B p50/ mice (2, 34). It should be noted that the p50/ mice are hybrids between C57B1/6 and 129 mouse strains. However, this is unlikely to account for the results observed.
NF-
B consists of a family of conserved proteins including RelB, p50, c-Rel, and RelA (p65). Heterodimers consisting of p65/p50 are thought to be key signaling molecules leading to the production of inflammatory proteins such as TNF-
, IL-1, NOS II, and COX-2 (19). We found that acute exposure of mice to ozone resulted in a biphasic induction of NF-
B nuclear binding activity in alveolar macrophages, which peaked after 612 h and at 48 h. These findings are in accord with previous reports on NF-
B induction in the lung after ozone inhalation (8, 12, 17, 35). We also noted that NF-
B p50 protein expression increased after ozone inhalation. The observation that this was more pronounced in nuclear compared with cytoplasmic extracts is consistent with NF-
B activation. The biphasic increase in NF-
B binding activity most likely reflects the distinct responses of resident and inflammatory macrophages to ozone. Similar increases in NF-
B binding activity have been described in the lung following exposure of animals to LPS or to silica, pulmonary irritants whose toxicity is also associated with excessive production of inflammatory mediators by alveolar macrophages (1, 13). We also found that tissue injury, as measured by bronchoalveolar lavage protein and nitrotyrosine staining of the lung, was prevented in NF-
B p50/ mice. These findings demonstrate that NF-
B plays a critical role in the pathogenesis of ozone-induced toxicity. NF-
B has also been implicated in lung injury induced by intrapulmonary deposition of immune complexes and carrageenan (4, 18). Inflammatory mediators are involved in tissue damage in both of these models. These results suggest that targeting NF-
B may be an effective approach to limiting inflammation and tissue injury.
Consistent with our previous studies (6, 22), we found that alveolar macrophages were primed by ozone inhalation to produce increased quantities of nitric oxide in response to inflammatory mediators. The fact that alveolar macrophages from NF-
B p50/ mice did not generate nitric oxide, even after ozone inhalation, demonstrates an essential role of NF-
B in this activity. Our results are in accord with previous reports on cultured macrophages that showed that inhibition of NF-
B abrogated nitric oxide production (33). NOS II is also known to be regulated by the transcription factor C/EBP. NF-
B and C/EBP have been reported to act cooperatively to induce nitric oxide production during acute and chronic inflammatory reactions (28). Ozone inhalation resulted in increased C/EBP nuclear binding activity in alveolar macrophages from wild-type animals, which is similar to findings in models of lung injury induced by bleomycin or LPS (7, 21). Interestingly, C/EBP migration in gel shift assays was more rapid in cells from ozone-treated mice. This suggests that ozone also causes modifications and/or changes in the composition of the proteins in C/EBP complex. These alterations in C/EBP may be important in regulating NOS II expression as well as other genes involved in the inflammatory response. The time course of the increases in C/EBP activity following ozone inhalation correlated with changes in NF-
B nuclear binding activity. Ozone inhalation had no effect on C/EBP nuclear binding activity in alveolar macrophages from NF-
B p50/ mice. These data indicate that increases in C/EBP binding activity are also dependent on NF-
B p50 and suggest that both transcription factors may be important in regulating NOSII during ozone-induced toxicity.
The expression of COX-2 is known to be regulated by NF-
B (19). However, our studies showed that constitutive COX-2 expression was significantly greater in NF-
B p50/ mice compared with wild-type mice. This suggests that NF-
B p50 or one of its downstream target genes may function as a negative regulator of COX-2 in this model. Alternatively, there may be compensatory increases in other signaling pathways regulating constitutive expression of COX-2 in NF-
B p50/ mice. After ozone inhalation, COX-2 expression increased in alveolar macrophages from wild-type mice. In contrast, no further increases were observed in cells from NF-
B p50/ mice. It may be that these cells are already expressing maximal levels of COX-2.
As observed in the rat model (23, 24), acute exposure of wild-type mice to inhaled ozone resulted in increased TNF-
expression in the lung with prominent staining in alveolar macrophages. This was not evident in NF-
B p50/ mice. These findings provide support for the idea that the NF-
B p50 subunit is essential for TNF-
expression and that this proinflammatory cytokine is important in ozone toxicity. Our findings are in accord with reports that TNF-
expression is reduced in NF-
B p50/ mice following exposure to ionizing radiation (36).
IL-10 has been identified as an important negative regulator of macrophages, inhibiting their ability to produce proinflammatory cytokines, including IL-1, TNF-
, and reactive oxygen and nitrogen intermediates (9). In accord with previous studies we found that ozone inhalation resulted in decreased IL-10 expression in the lungs of wild-type mice (27). IL-10 is known to suppress I
B kinase and inhibit NF-
B DNA binding activity, thus limiting the generation of potentially toxic inflammatory mediators (29). Increased generation of inflammatory mediators in the lung after ozone exposure may be due to activation of NF-
B in the presence of reduced levels of IL-10. In contrast to its effects in wild-type mice, ozone inhalation had no effect on IL-10 expression in NF-
B p50/ mice. This most likely reflects decreased generation of inflammatory mediators that suppress IL-10 expression.
The present studies provide support for our model that macrophages and inflammatory mediators contribute to ozone toxicity (16). According to this model, ozone-induced epithelial damage leads to the rapid release of TNF-
by alveolar macrophages. TNF-
acts on resident and inflammatory macrophages and type II cells to activate signaling pathways leading to expression of NOS II and excessive production of reactive nitrogen intermediates. We speculate that macrophage and type II cell hyperresponsiveness is due to increased expression or persistent activation of transcription factors such as NF-
B and C/EBP, which bind to the NOS II promoter and cooperatively interact to induce NOS II activity. This model is consistent with findings that persistent activation of NF-
B leads to the production of excessive quantities of proinflammatory mediators, resulting in tissue damage and organ failure (19, 32). Additional studies are required to determine the precise mechanisms by which NF-
B controls expression of TNF-
and NOS II in the different lung cell types and their role in ozone-induced lung injury.
| GRANTS |
|---|
|
|
|---|
| ACKNOWLEDGMENTS |
|---|
B p50/ mice. | FOOTNOTES |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
| REFERENCES |
|---|
|
|
|---|
receptors. Am J Physiol Lung Cell Mol Physiol 280: L537L546, 2001.
. Am J Respir Cell Mol Biol 30: 280287, 2004.
B-dependent gene expression by silica in lungs of luciferase reporter mice. Am J Physiol Lung Cell Mol Physiol 282: L968L975, 2002.
B and AP-1. Am J Physiol Lung Cell Mol Physiol 282: L1209L1221, 2002.This article has been cited by other articles:
![]() |
K. C. Verhein, D. B. Jacoby, and A. D. Fryer IL-1 Receptors Mediate Persistent, but Not Acute, Airway Hyperreactivity to Ozone in Guinea Pigs Am. J. Respir. Cell Mol. Biol., December 1, 2008; 39(6): 730 - 738. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. W. Hollingsworth, S. R. Kleeberger, and W. M. Foster Ozone and Pulmonary Innate Immunity Proceedings of the ATS, July 1, 2007; 4(3): 240 - 246. [Abstract] [Full Text] [PDF] |
||||
![]() |
H.-Y. Cho, D. L. Morgan, A. K. Bauer, and S. R. Kleeberger Signal Transduction Pathways of Tumor Necrosis Factor-mediated Lung Injury Induced by Ozone in Mice Am. J. Respir. Crit. Care Med., April 15, 2007; 175(8): 829 - 839. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Liu, K. P. Lehmann, M. Sar, S. S. Young, and K. W. Gaido Gene Expression Profiling Following In Utero Exposure to Phthalate Esters Reveals New Gene Targets in the Etiology of Testicular Dysgenesis Biol Reprod, July 1, 2005; 73(1): 180 - 192. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |