| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
regulation in airway smooth muscle by IL-1
and TNF-: role of NF-
B and MAP kinases
1Experimental Studies, National Heart and Lung Institute, Imperial College, and 2Cardiothoracic Surgery, St. Mary's Hospital, London, United Kingdom
Submitted 8 September 2005 ; accepted in final form 6 December 2005
 |
ABSTRACT |
|---|
 TOP ABSTRACT METHODSRESULTSDISCUSSIONGRANTSREFERENCES |
|---|
(GRO-) from ASMC induced by cytokines and the role of MAPK and NF-
B pathways. ASMC were cultured from human airways, grown to confluence, and exposed to cytokines IL-1
and TNF- after growth arrest. GRO- release, measured by ELISA, was increased by >50-fold after IL-1 (0.1 ng/ml) or 5-fold after TNF- (1 ng/ml) in a dose- and time-dependent manner. GRO- release was not affected by the T helper type 2 cytokines IL-4, IL-10, and IL-13. IL-1 and TNF- also induced GRO- mRNA expression. Supernatants from IL-1-stimulated ASMC were chemotactic for neutrophils; this effect was inhibited by anti-GRO- blocking antibody. AS-602868, an inhibitor of IKK-2, and PD-98059, an inhibitor of ERK, inhibited GRO- release and mRNA expression, whereas SP-600125, an inhibitor of JNK, reduced GRO- release without effect on mRNA expression. SB-203580, an inhibitor of p38 MAPK, had no effect. AS-602868 but not PD-98059 or SP-600125 inhibited p65 DNA-binding induced by IL-1 and TNF-. By chromatin immunoprecipitation assay, IL-1 and TNF- enhanced p65 binding to the GRO- promoter, which was inhibited by AS-602868. IL-1- and TNF--stimulated expression of GRO- from ASMC is regulated by independent pathways involving NF-B activation and ERK and JNK pathways. GRO- released from ASMC participates in neutrophil chemotaxis.
growth-related oncogene protein-; extracellular signal-regulated kinase; c-Jun NH2-terminal kinase; nuclear factor-B
also induced the expression of the CXC chemokines growth-related oncogene protein (GRO)-, -, and -
(16). GRO- was first isolated and characterized by its growth stimulatory activity on malignant melanoma cells (28), and, similar to IL-8, it has neutrophil chemotactic activity with a major role in the recruitment and activation of neutrophils at sites of inflammation (23). However, there is little information on the regulation of GRO- expression and release from ASMC.
MAPKs are a family of serine/threonine kinases that transduce extracellular signals to the nucleus. In mammalian cells, three major groups of MAPKs that differ in their substrate specificity have been characterized: ERK, JNK, and p38 MAPK. Activation of MAPKs requires dual phosphorylation on threonine and tyrosine by upstream kinases and occurs in response to diverse stimuli such as environmental stress, endotoxins, mitogenic stimuli, and proinflammatory cytokines (IL-1 and TNF-) (8, 19). Once activated, MAPKs phosphorylate selected intracellular proteins, including transcription factors that result in changes in gene expression that affect cellular processes such as proliferation, differentiation, survival, and inflammation. MAPKs participate in gene regulation and release of cytokines and chemokines from ASMC; for example, IL-8 protein release stimulated by IL-1, TNF-, and IFN- was partially blocked by the ERK inhibitor PD-98059 or by a p38 MAPK inhibitor, SB-203580 (9).
In the present study, we investigated the effect of proinflammatory cytokines IL-1 and TNF- in the induction and release of GRO- from ASMC in culture and the role of GRO- as a neutrophil chemoattractant. We also determined the role of MAPK pathways in the induction of GRO- by using selective inhibitors of the ERK, JNK, and p38 MAPK pathways. In addition to the MAPK pathways, we also determined the role of the ubiquitous transcription factor NF-B, as well as NF-B p65 binding to GRO- promoter. The GRO- promoter region contains NF-B DNA-binding sites (3), and NF-B activation represents an important pathway mediating GRO- secretion in several cell types. Both IL-1 and TNF- stimulate NF-B activation in ASMC (2, 33), and TNF--induced expression of the chemokines IL-8 and eotaxin has been shown to be NF-B dependent (25, 27).
|
METHODS |
|---|
|
TOPABSTRACTMETHODSRESULTSDISCUSSIONGRANTSREFERENCES |
|---|
, TNF-, IL-4, IL-10, IL-13, GRO-, anti-GRO- antibody, and matched antibody pairs for GRO- ELISA were purchased from R&D Systems (Abingdon, UK). The p38 MAPK inhibitor SB-203580 and the MEK inhibitor PD-98059 were purchased from Calbiochem (Nottingham, UK). The JNK inhibitor SP-600125 (4) was a gift from Dr. Brydon Bennett (Celgene, San Diego, CA) and the IKK-2 inhibitor AS-602868 (11) from Serono Laboratories (Basel, Switzerland). The antibodies for Western blotting (JNK, phospho-JNK, ERK, phospho-ERK, p38, phospho-p38, IB-, and phospho-IB-) were purchased from New England BioLabs (Beverly, MA).
Isolation of human ASMC.
Human ASMC were dissected out from lobar or main bronchus obtained from patients undergoing lung resection for carcinoma of the bronchus, as previously described (26). The collection of human samples was approved by the Ethics Committees of the Royal Brampton Hospital and of St. Mary’s Hospital. Cells were maintained in DMEM containing 10% FCS supplemented with sodium pyruvate (1 mM), L-glutamine (2 mM), nonessential amino acids (1:100), penicillin (100 U/ml), streptomycin (100 µg/ml), and amphotericin B (1.5 µg/ml) in a humidified atmosphere at 37°C in air-CO2 (95%-5% vol/vol). Confluent cells were passaged with 0.25% trypsin and 1 mM EDTA. ASMC at passages 3–7 from nine different donors were used in the studies described below. ASMC were characterized by positive immunostaining for calponin, smooth muscle -actin, and myosin heavy chain.
Measurement of GRO- release.
ASMC were plated at a seeding density of 1 x 104 cells/cm2 in 12-well plates. Confluent cells were serum deprived for 24 h in serum-free medium (SFM) consisting of DMEM supplemented with sodium pyruvate (1 mM), L-glutamine (2 mM), nonessential amino acids (1:100), penicillin (100 U/ml), streptomycin (100 µg/ml), amphotericin B (1.5 µg/ml), BSA (0.1%), and ascorbic acid (100 µM). Cells were stimulated in duplicate for 24 h in fresh SFM containing cytokines IL-1 (0.001–10 ng/ml) or TNF- (0.01–20 ng/ml). To examine whether the GRO- release was time dependent, the cells were stimulated with IL-1 (0.1 ng/ml) or TNF- (1 ng/ml) at different time points from 1 h up to 72 h. The cells were also stimulated with IL-1 (0.1 ng/ml) or TNF- (1 ng/ml) alone or in the presence of T helper type 2 (Th-2) cytokines IL-4, IL-10, or IL-13, each at 10 ng/ml. After appropriate incubation times, the supernatants were collected and stored at –20°C. GRO- levels were measured by using a dual-set ELISA kit (R&D Systems) according to the manufacturer's instructions. The samples were diluted until the cytokine level was within the linear range of the standard curve.
Neutrophil chemotaxis assay. Briefly, blood was collected into sterile heparinized syringes from the peripheral veins of normal donors after informed consent was obtained. Peripheral venous blood was mixed with acid-citrate dextrose (1:6 vol/vol) and sedimented on dextran (6% in 0.9% NaCl) for 40 min. The neutrophil fraction was obtained by plasma-Percoll density gradient centrifugation. Cells were washed twice with HBSS and resuspended (106 cells/ml) in complete chemotaxis buffer (RPMI plus 0.5% BSA).
Human neutrophil chemotaxis was measured in Falcon 24-well plates containing Transwell inserts (Corning Glass, Corning, NY). Chemotactic properties of supernatants taken from IL-1 (0.1 ng/ml)-stimulated ASMC or nonstimulated controls were evaluated by measuring the neutrophil migration through a 3-µm polycarbonate filter. Transwell inserts containing 250 µl of purified cells (106 cells/ml) were placed in wells containing chemotaxis buffer only or GRO- (10 ng/ml) or various dilutions of supernatants of unstimulated control or IL-1-stimulated ASMC at dilutions of 1:1, 1:15, and 1:50. Studies were also performed with or without prior incubation with neutralizing anti-GRO- antibody for 15 min at room temperature. After 1.5 h of incubation at 37°C with 5% CO2, cells that transmigrated into the lower chamber were recovered by centrifugation. The number of migrated cells was determined with a colorimetric lactate dehydrogenase (LDH) assay (CytoTox 96 nonradioactive cytotoxicity assay; Promega, Madison, WI). Briefly, migrated cells were lysed with 1% Triton X-100 for 30 min, and the plates were centrifuged at 250 g for 12 min. The supernatants were transferred to an Immulon 96-well microtiter plate, the LDH assay reagents were added and incubated for 45 min, and the reaction was stopped and absorbance was measured at 490 nm. The LDH measurements from the effects of recombinant human GRO- (10 ng/ml) was given a value of 100. Data are expressed as a percentage of the response to GRO-.
RNA preparation and real-time PCR.
Cells were plated at a seeding density of 1 x 104 cells/cm2 in six-well plates. The 24-h serum-deprived confluent cells were stimulated in duplicate with IL-1 (0.1 ng/ml) or TNF- (1 ng/ml) for 2 h, either alone or in the presence of PD-980590 (25 µM), SP-600125 (10 µM), or AS-602868 (2.5 µM) for 24 h. Cells were harvested and total RNA was isolated with the Qiagen RNase easy extraction kit (RNeasy Mini; Qiagen, Crawley, UK) according to the manufacturer's instructions.
First-strand cDNA was synthesized in a volume of 60 µl containing 0.5 µg of total RNA. For the real-time PCR, 5 µl of the RT-PCR first-strand cDNA and 0.5 µM of primers were used in a total 20-µl reaction containing 10 µl of Universal SYBRgreen Master mix (Qiagen). The primers used were: GRO-, ATGGCCCGCGCTGCTCTCTCC (forward) and GTTGGATTTGTCACTGTTCAG (reverse); GAPDH, GAAGATGGTGATGGGATTTC (forward) and GAPDH GAAGGTGAAGGTCGGAGT (reverse). A known concentration of GAPDH cDNA was also used as a standard, using GAPDH primers to be amplified in parallel with the sample template. The conditions of the reaction were as follows: denaturing at 95°C for 15 min followed by a denaturing step (20 s at 94°C) and an annealing step (60°C for 20s) for 45 cycles. Determination of the expression of the housekeeping gene GAPDH was performed in a parallel tube, and all reactions were undertaken in duplicate. Target mRNA was normalized to GAPDH mRNA, expressed relative to control, which was given a value of 1 for each donor.
Effect of MAPK inhibitors on GRO- release.
Confluent serum-deprived ASMC were preincubated for 1 h with the JNK inhibitor SP-600125 (10–50 µM), the p38 inhibitor SB-203580 (0.5–2 µM), or the MEK inhibitor PD-98059 (10–50 µM), DMSO vehicle controls, or the diluents alone in fresh SFM before addition of IL-1 (0.1 ng/ml) or TNF- (1 ng/ml). The supernatants were collected 24 h after incubation at 37°C in a CO2 incubator and stored at –20°C. Colorimetric dyes 3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2H-tetrazolium bromide (MTT) and crystal violet were used to measure the viability and the number of the remaining cells, respectively, in each plate.
Effect of NF-B inhibition on GRO- release.
IKK-2 is essential for NF-B activation, and to inhibit NF-B activation we therefore studied the effect of an inhibitor of IKK-2, AS-602868. ASMC were preincubated for 1 h with AS-602868 (1–10 µM) or the DMSO diluent before addition of IL-1 (0.1 ng/ml) or TNF- (1 ng/ml). The supernatants were collected 24 h later.
Measurements of NF-B activity.
To determine the effect of AS-602868 in blocking NF-B activity in human ASMC, an ELISA-based assay (TransAM Transcription Factor Assay Kit, Active Motif Europe) to determine the binding activity of p65, a component of NF-B, was used. Serum-starved ASMC were pretreated with AS-602868 (1, 2.5, 5, and 10 µM) for 1 h before addition of either IL-1 (0.1 ng/ml) or TNF- (1 ng/ml) for 1 h. Briefly, 5 µg of nuclear protein samples was incubated for 1 h in a 96-well plate coated with an oligonucleotide that contains a p65 consensus site (5'-GGGACTTTCC-3'), to which phosphorylated p65 in nuclear extracts specifically binds. After washing, p65 antibody was added to these wells and incubated for 1 h. After incubation for 1 h with a secondary horseradish peroxidase (HRP)-conjugated antibody (1:1,000 dilution), specific binding was detected by colorimetric estimation at 450 nm with a reference wavelength of 655 nm.
Western blot of phosphorylated JNK, ERK, p38, and IKB-.
Confluent serum-deprived cells at a seeding density of 1 x 104 cells/cm2 in SFM for 24 h were preincubated for 1 h with IL-1 (0.1 ng/ml) in the presence or absence of AS-602868 (1–2.5 µM), the MEK inhibitor PD-98059 (25 µM), or the JNK inhibitor SP-600125 (10 µM). The cells were collected after incubation for 15 min at 37°C in a CO2 incubator. The cells were rinsed with ice-cold PBS and lysed in radioimmunoprecipitation assay buffer [PBS containing 0.5% sodium deoxycholate, 0.1% SDS, 1% Igepal, 200 µM Na3VO4, and protease inhibitor cocktail (1 tablet/10 ml buffer)]. Cells were scraped off the wells and solubilized by sonication followed by centrifugation (10,000 g, 4°C, 4 min). Protein concentrations were determined with a protein assay kit (Pierce Chemical, Rockford, IL).
Total protein extracts heated at 90°C for 5 min were separated by SDS-PAGE (20 µg/lane) using 4–12% polyacrylamide precast gel (Novex, Invitrogen, Paisley, UK), transferred to membranes, and blotted with anti-phosphorylated threonine and tyrosine residues of JNK, p38 MAP, and p42/p44 MAPK (1:1,000), according to the manufacturer's instructions (New England Biolabs). After washing with phosphate-buffered saline and Tween 20 mixture (PBS/T), the membrane was incubated with HRP-conjugated secondary antibody (goat anti-rabbit IgG; 1:2,000) for 1 h at room temperature. Membranes were thoroughly washed with PBS/T and visualized by enhanced chemiluminescence (LumiGLO; KPL Europe, Guildford, UK). The membranes were reprobed with phosphorylation state-independent anti-JNK, anti-p38, and anti-ERK antibodies. To confirm equal protein loading, a mouse anti-GAPDH monoclonal antibody (1:20,000) was also applied.
Band intensities on autoradiographs were quantified with software from Ultra-Violet Products (Cambridge, UK). Densitometric data for the phosphorylated band were normalized for equal loading by dividing the phosphorylated value by the total nonphosphorylated band and then normalized to unstimulated control cells, which were set to 1.0.
Chromatin immunoprecipitation assay.
The chromatin immunoprecipitation (ChIP) assay is a powerful technique to determine true in vivo binding of transcription factors and other nucleosomal proteins to chromatin in response to an agonist. We used this assay to determine the status of the NF-B transcription complex at the promoters of key NF-B-regulated genes in ASMC in response to IL-1 or TNF-.
Serum-starved ASMC were pretreated with either DMEM containing AS-602868 (2.5 µM) or DMEM alone for 1 h before addition of either IL-1 (0.1 ng/ml) or TNF- (1 ng/ml) for an additional 2 h. After stimulation, protein-DNA complexes were cross-linked by formaldehyde (1% final concentration). Cells were resuspended in 200 µl of SDS lysis buffer (50 mM Tris, pH 8.1, 1% SDS, 5 mM EDTA, complete proteinase inhibitor mixture). The suspension was subjected to five cycles of sonication on ice with 10-s pulses followed by centrifugation for 10 min. Supernatants were collected, and one-tenth of the total lysate was used for total genomic DNA as "input DNA" control. The rest of the supernatants were diluted in buffer (1% Triton X-100, 2 mM EDTA, 150 mM NaCl, 20 mM Tris·HCl, pH 8.1, 1x protease inhibitor mixture) followed by immunoclearing with 1 µg of sheared salmon sperm DNA, and 20 µl of protein A-Sepharose (Upstate Biotechnology) for 30 min at 4°C. The soluble chromatin solution was immunoprecipitated by using antibodies specific for p65 (Santa Cruz Biotechnology, Santa Cruz, CA). Protein-bound immunoprecipitated DNA was washed with LiCl wash buffer and 10 mM Tris-1 mM EDTA, pH 8.0 buffer, and immune complexes were eluted by adding elution buffer (1% SDS, 0.1 M NaHCO3). Eluates were pooled and heated at 65°C for at least 4 h in 200 mM NaCl-1% SDS to reverse the formaldehyde cross-linking. This was followed by incubation for 1 h at 45°C with 70 µg/ml proteinase K (Sigma). DNA fragments were purified with phenol-chloroform followed by precipitation with ethanol-0.3 M NaHCOOH-20 µg glycogen. The pellet was resuspended in nuclease-free water. Quantitative PCR was performed with DNA samples from both samples and input for quantifications. Real-time PCR was performed in a Rotor-Gene 3000TM four-channel multiplexing system (Corbett Research, Sydney, Australia), using a QuantiTect SYBRgreen PCR Kit (Qiagen) to quantify the immunoprecipitated DNA from ChIP assays. The PCR primers correspond to sequences within the promoter regions as follows: GRO- forward (5'-CGT CGC CTT CCT TCC GGA CTC G-3') and reverse (5'-GCT CTC CGA GAT CCG CGA ACCC-3'). Cycle parameters were 95°C for 15 min to activate HotStarTaq DNA Polymerase, followed by annealing and extension at 45 cycles of 94°C for 15 s, 60°C for 25 s, and 72°C for 25 s. The samples were normalized with each corresponding input. Data are expressed relative to the untreated control, which was given a value of 1 for each donor.
Data analysis. Data are presented as means ± SE. Data were compared with one-way ANOVA followed by Newman-Keuls post hoc test to determine statistical differences after multiple comparisons. A P value of <0.05 was considered significant.
|
RESULTS |
|---|
|
TOPABSTRACTMETHODSRESULTSDISCUSSIONGRANTSREFERENCES |
|---|
and TNF- induce GRO- release and expression.
ASMC cultured in medium alone for 24 h released GRO- into the culture supernatant, but this was increased after stimulation with IL-1 (0.001–10 ng/ml) or TNF- (0.01–20 ng/ml) (Fig. 1A). Both induced GRO- release compared with GRO- released from control in a dose-dependent manner. Near-maximal release occurred with 0.1 ng/ml IL-1 and after 72 h of stimulation, when the release was still increasing (Fig. 1B). The difference in amounts of GRO- released with IL-1 stimulation (0.1 ng/ml) shown in Fig. 1, A and B, illustrates the variability of the response of ASMC from the different donors used in the two experiments. TNF- stimulation caused near-maximal GRO- release at 1 ng/ml and at 72 h (Fig. 1). IL-1 was more potent in inducing GRO- than TNF-. There was further increase in GRO- release when IL-1 (0.1 ng/ml) and TNF- (1 ng/ml) were added together compared with each cytokine alone (see 
Fig. 3A).
|
|
mRNA expression significantly increased after IL-1 (0.1 ng/ml) or TNF- (1 ng/ml) stimulation over the nonstimulated controls at 2 h (Fig. 1C). GRO- mRNA expression was also increased (P < 0.01, n = 4) after treatment with a mixture of IL-1 and TNF- over stimulation with each cytokine alone (Fig. 1C).
To determine whether the IL-1 and TNF- effect on GRO- expression was protein synthesis dependent, ASMC were pretreated with the protein synthesis inhibitor cycloheximide (10 µg/ml; 30 min) before cytokine treatment. IL-1 and TNF- induced GRO- mRNA. The addition of cycloheximide alone caused superinduction of GRO- mRNA expression. Cycloheximide together with each cytokine induced significantly higher GRO- mRNA than in the presence of each cytokine alone at 24 h (P < 0.01, n = 5; Fig. 2A). Similar data were also observed at 2 h (not shown). Cycloheximide significantly inhibited both IL-1 (P < 0.001, n = 6)- and TNF- (P < 0.001, n = 4)-induced GRO- release at 24 h (Fig. 2B).
|
-stimulated ASMC supernatants on neutrophil chemotaxis.
Neutrophil chemotaxis assay was performed to determine whether the GRO- released after IL-1 stimulation was biologically active. Supernatants taken from IL-1 (0.1 ng/ml)-stimulated ASMC for 24 h induced neutrophil chemotaxis with a threefold increase compared with supernatants taken from nonstimulated ASMC (Fig. 3A). Although there was more neutrophil chemotaxis at the 1:15 dilution, there was overall little difference between the 1:1, 1:15, and 1:50 dilutions of the supernatants. The neutralizing anti-GRO- antibody significantly reduced neutrophil chemotaxis of supernatant from IL-1-treated ASMC (P < 0.001, n = 4; Fig. 3B). These data indicate that IL-1-mediated ASMC release of GRO- may participate in neutrophil recruitment.
Effect of IL-4, IL-10, and IL-13 on GRO- release.
The Th-2 cytokines IL-4, IL-10, and IL-13 had no significant effect on the baseline release of GRO- (n = 5). These cytokines also did not alter the stimulatory effect of IL-1 or TNF- on GRO- release (data not shown).
Effect of MAPK inhibitors on GRO- release and expression.
The JNK inhibitor SP-600125 attenuated both IL-1- and TNF--induced GRO- release in a dose-dependent manner (P < 0.001, n = 7; Fig. 4A). Similarly, the MEK inhibitor PD-98059 reduced GRO- release induced by IL-1 (at 25 µM P < 0.01, at 50 µM P < 0.001; n = 5) (Fig. 4B). PD-98059 also inhibited TNF--induced GRO- release (at 10 µM P < 0.01, at 50 µM P < 0.001; n = 4) (Fig. 4B). The inhibitory effect of the p38 inhibitor SB-203580 on GRO- release was minor, being only significant at 1 µM (P < 0.05, n = 8) but not at 2 µM (Fig. 4C). Only PD-98059 significantly inhibited GRO- mRNA expression induced by IL-1 (P < 0.01, n = 6) and by TNF- (P < 0.05, n = 5). SP-600125 had no significant effect on GRO- mRNA expression (Fig. 4D). The apparent increase in IL-1-induced GRO- mRNA in the presence of SP-600125 was due to one of the six donors studied.
|
release and expression.
AS-602868 caused a concentration-dependent inhibition of GRO- release induced by both IL-1 (P < 0.001, n = 6; Fig. 5A) and TNF- (at 1 µM P < 0.05, at 2.5 µM P < 0.01, at 5 µM and 10 µM P < 0.001; n = 6; Fig. 5B). This inhibitor also inhibited GRO- mRNA expression (P < 0.001, n = 4; Fig. 5C). Cell viability was not changed by AS-602868.
|
B and ERK pathways were activated simultaneously but independently by IL-1, we examined the effect of both inhibitors on GRO- release. We found that in the presence of both inhibitors at the submaximal doses (AS-602868 2 µM and PD-98059 10 µM), there was significantly more suppression of GRO- release than in the presence of either inhibitor alone (Fig. 5D).
Effect of inhibitors on IL-1- and TNF--induced NF-B activation.
p65 binding was increased by IL-1 after 1 h (P < 0.001), an effect reduced by preincubation with AS-602868 in a dose-dependent manner (at 1 µM P < 0.01, at 2.5–10 µM P < 0.001; n = 6; Fig. 6A). Similarly, TNF- significantly induced NF-B activation (P < 0.001, n = 6), which was inhibited by AS-602868 (Fig. 6B).
|
B pathways are necessary for GRO- expression and there is upstream NF-B binding site on GRO- promoter, we determined whether ERK and JNK activation were associated with NF-B. The IL-1 and TNF- stimulation of p65 binding was not significantly altered by SP-600125 or PD-98059 (data not shown).
To determine further the interactions of NF-B activation and the ERK and JNK pathways, we determined whether the IB- phosphorylated state induced by IL-1 was affected by SP-600125 or PD-98059. We found no significant effect of SP-600125 (10 µM) or PD-98059 (25 µM) on IB- phosphorylation as measured by Western blotting. In addition, the IKK-2 inhibitor AS-602868 (1 µM), which significantly inhibits GRO- expression, had no effect on either stress-activated protein kinase/JNK phosphorylation or p42/44 ERK phosphorylation induced by IL-1 (data not shown).
Effect of AS-602868 on NF-B p65 binding to GRO- promoter.
Serum-starved confluent human ASMC were subjected to ChIP with an anti-p65 antibody. Enrichment of specific DNA sequences in the chromatin immunoprecipitates indicates association of these ligand factors to DNA strands within intact chromatin. This was visualized by PCR amplification. Normalized samples with total input DNA control amplification (input DNA) showed a marked enrichment of the GRO- promoter DNA after both IL-1 (0.1 ng/ml; P < 0.001, n = 3) and TNF- (1 ng/ml; P < 0.01, n = 3) at 2 h. This p65 immunoprecipitate enrichment of the GRO- promoter was significantly reduced after AS-602868 (2.5 µm) for IL-1 and for TNF- (Fig. 7).
|
|
DISCUSSION |
|---|
|
TOPABSTRACTMETHODSRESULTSDISCUSSIONGRANTSREFERENCES |
|---|
, in response to cytokines IL-1 and TNF- but not in response to the Th-2 cytokines IL-4, IL-10, and IL-13. GRO- released from ASMC stimulated by IL-1 was active in causing neutrophil chemotaxis. The induction of GRO- by IL-1 and TNF- involved the ERK and JNK pathways, with little contribution by the p38 MAPK pathway, in contrast to the induction of IL-8, which is dependent partly on ERK and p38 MAPK (13). The proinflammatory cytokines IL-1 and TNF- stimulated GRO- expression and release from ASMC in a dose- and time-dependent manner, with IL-1 being more potent than TNF-. Although at the mRNA level the combined effect of IL-1 and TNF- appeared to be additive, the level of GRO- released was greater than that compared with each cytokine alone, indicating some degree of synergy.
The Th-2 cytokines IL-4, IL-10, and IL-13 had no significant effect on GRO- release and were also without effect on IL-1- or TNF--induced GRO- release. The regulation of GRO- appears to be different from that of another CXC chemokine, IL-8, known to be released from ASMC. For example, the Th-2 cytokines IL-4, IL-10, and IL-13, had an inhibitory effect on IL-8 and RANTES release stimulated by TNF- and IFN- in ASMC (17, 18), whereas IL-10 inhibited eotaxin release (7). On the other hand, IL-4 and IL-13 potentiated the stimulatory effect of IL-1 or TNF- on eotaxin release (15). Therefore, Th-2 cytokines may differ in their actions depending on the gene targeted in the same cell type. In addition, there are cell-specific differences because IL-4 and IL-13 can stimulate GRO- mRNA expression in human nasal and human bronchial epithelial cells (21).
Our study of the involvement of MAPK pathways depends on the selectivity of the inhibitors used. The selectivity of SP-600125 as a JNK inhibitor (26), of SB-203580 as a p38 MAPK inhibitor (12), and of PD-98059 as an ERK inhibitor (9, 13) at the concentrations used has been previously shown for ASMC. Synthesis of the chemokines RANTES, eotaxin, and IL-8 in ASMC is dependent on ERK, JNK, and p38 MAPK pathways, but the release of GRO- is dependent on ERK and JNK but not p38 pathways. Gene expression was only dependent on the ERK pathway, indicating that JNK activation may be important in regulating GRO- release through posttranscriptional mechanisms. IL-1 induction of eotaxin is inhibited by either MKK1 inhibitors or p38 MAPK inhibitors (15, 22), whereas RANTES synthesis induced by TNF- is insensitive to inhibition of both ERK or p38 MAPK activation (1); in contrast, IL-1-induced RANTES release is sensitive to MKK1 inhibition but not to p38 MAPK inhibition (12). However, JNK activation is involved in both IL-1- and TNF--induced RANTES and IL-8 release, being more important in RANTES release (26). Therefore, the involvement of various MAPK pathways depends on the stimulus and the released chemokine.
The GRO- promoter region contains a variety of DNA binding sites, including those for activator protein-1 and NF-B (3). NF-B activation represents a major pathway mediating GRO- secretion in several cell types. Furthermore, both IL-1 and TNF- stimulate NF-B activation in ASMC (2, 33). In our study, GRO- expression was shown to be dependent on activation of NF-B, because an inhibitor of IKK-2 inhibited both IL-1- and TNF--induced GRO- mRNA expression and release. At the same time, the IKK-2 inhibitor also inhibited IL-1- and TNF--induced p65 activation. Similarly, the release of IL-8 and GM-CSF from ASMC exposed to IL-1 or TNF- was inhibited by another IKK-2 inhibitor (5). To further prove the involvement of NF-B, we used the ChIP assay to show the in vivo p65 binding to GRO- promoter induced by IL-1 or TNF-. The ChIP assay is a powerful technique to determine true in vivo binding of transcription factors and other nucleosomal proteins to chromatin in response to cytokines. We used this assay to determine the status of the NF-B transcription complex at the promoters of key NF-B-regulated genes in ASMC in response to IL-1 or TNF-. By using a specific antibody to the p65 subunit of NF-B, we evaluated the recruitment of NF-B p65 subunits. Gene promoter regions were amplified and analyzed by semiquantitative PCRs using specific primer pairs around NF-B binding regions on the promoters of GRO-. Enrichment of specific DNA sequences in chromatin immunoprecipitation indicated association of the antigen (p65) with specific NF-B DNA binding sites within intact chromatin. This binding was significantly increased by the cytokines, an effect that was reduced in the presence of the IKK-2 inhibitor.
It has been reported that ERK or JNK activation can induce phosphorylation of both IKK- and IKK-, leading to NF-B activation (10, 14). In our study, cross talk between these pathways is also suggested by the more complete inhibition of GRO- release with the IKK-2 inhibitor compared with the partial inhibition by the MAPK inhibitors. However, we found that NF-B binding activity and IB- phosphorylation induced by IL-1 were not significantly inhibited by the ERK inhibitor PD-98059 or the JNK inhibitor SP-600125, in agreement with a previous report (33). Furthermore, no inhibition of ERK or JNK phosphorylation was observed in the presence of the IKK-2 inhibitor AS-602868 at a concentration that caused significant inhibition of GRO- release. We also showed that p65 binding induced by IL-1 and TNF- was not significantly altered by the MAPK inhibitors SP-600125 or PD-98059. These data indicate that ERK MAPK activation and NF-B activation induced by IL-1 independently regulated gene expression of GRO- in ASMC. As discussed above, posttranscriptional mechanisms may be responsible for the inhibition of GRO- release caused by SP-600125. Further investigations are required to definitely exclude any potential cross talk between these pathways.
The protein synthesis inhibitor cycloheximide alone and together with IL-1 or TNF- induced GRO- mRNA expression, indicating that there are inhibitory proteins that control GRO- expression; these could lead to increased mRNA stabilization as well as further activation of transcription factors such as NF-B and c-Jun as shown in other cell types for cyclooxygenase-2 mRNA expression (24, 29). Cycloheximide inhibited GRO- release induced by IL-1 or TNF-, suggesting that GRO- release required de novo protein synthesis.
GRO-, which is increased in the sputum of patients with chronic obstructive pulmonary disease (COPD) (32), has neutrophil and monocytic chemotactic and angiogenic activities and plays an important role during the inflammatory response (23). Therefore, ASMC may be an important source of GRO- in the airways, particularly when exposed to proinflammatory cytokines such as IL-1 and TNF- that are overexpressed in airway diseases, including asthma and COPD (20, 31). The released GRO- may contribute to neutrophil chemotaxis into the airways. Inhibition of GRO- expression and release may be achieved through the suppression of NF-B activation and, independently of NF-B, by inhibition of ERK and JNK pathways.
|
GRANTS |
|---|
|
TOPABSTRACTMETHODSRESULTSDISCUSSIONGRANTSREFERENCES |
|---|
|
FOOTNOTES |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
|
REFERENCES |
|---|
|
TOPABSTRACTMETHODSRESULTSDISCUSSIONGRANTSREFERENCES |
|---|
-induced secretion of RANTES and interleukin-6 from human airway smooth-muscle cells. Modulation by cyclic adenosine monophosphate. Am J Respir Cell Mol Biol 23: 794–802, 2000.B-dependent signaling pathway that is only partially sensitive to dexamethasone. J Immunol 163: 2128–2134, 1999.B-like transcription factor mediates IL-1/TNF- induction of gro in human fibroblasts. J Immunol 147: 520–527, 1991.[Abstract]-B kinase-2 inhibitor blocks inflammation in human airway smooth muscle and a rat model of asthma. Am J Respir Crit Care Med 172: 962–971, 2005. and TNF: effects of IL-10 and corticosteroids. Br J Pharmacol 127: 1145–1150, 1999.[CrossRef][ISI]B activation by the enhanced and sustained degradation of IB. Biochem Biophys Res Commun 283: 248–254, 2001.[CrossRef][ISI][Medline]-induced NF-B activation and degradation of IB-. J Biol Chem 271: 13234–13238, 1996. and is mediated by the interleukin-4 receptor -chain. Am J Respir Crit Care Med 165: 1161–1171, 2002., interleukin-13 and transforming growth factor-beta on gene expression in human airway smooth muscle using gene microarrays. Eur J Pharmacol 497: 255–265, 2004.[CrossRef][ISI][Medline] in induced sputum from patients with chronic obstructive pulmonary disease or asthma. Am J Resp Crit Care Med 153: 530–534, 1996.[Abstract]) and CC (RANTES, eotaxin, eotaxin-2, MCP-3 and MCP-4) chemokines in human airway epithelial cells. Int Arch Allergy Immunol 131: 264–271, 2003.[CrossRef][ISI][Medline] involves increased transcription and correlates with increased NF-B and JNK activation. FEBS Lett 418: 135–138, 1997.[CrossRef][ISI][Medline] agonists: interactions with glucocorticoids and 2-agonists. J Biol Chem 280: 2550–2561, 2005.B mediated inflammation by siRNA expressed by recombinant adeno-associated virus. J Virol Methods 120: 119–122, 2004.[CrossRef][ISI][Medline]. Evidence for post-transcriptional regulation. J Biol Chem 269: 11769–11775, 1994. and IL-1 receptor antagonist (IL-1 ra) expression in asthmatic bronchial epithelium. Thorax 52: 407–410, 1997.[Abstract] and MCP-1 in sputum samples from patients with COPD. Thorax 57: 590–595, 2002.B in IL-1-induced VCAM-1 expression in human tracheal smooth muscle cells. Am J Physiol Lung Cell Mol Physiol 288: L227–L237, 2005.1-induced connective tissue growth factor expression in airway smooth muscle cells. Am J Physiol Lung Cell Mol Physiol 288: L68–L76, 2005.B-dependent transcriptional activation. J Clin Invest 97: 421–430, 1996.[ISI][Medline]This article has been cited by other articles:
|
|
 |
|
  T. Quante, Y. C. Ng, E. E. Ramsay, S. Henness, J. C. Allen, J. Parmentier, Q. Ge, and A. J. Ammit Corticosteroids Reduce IL-6 in ASM Cells via Up-Regulation of MKP-1 Am. J. Respir. Cell Mol. Biol., August 1, 2008; 39(2): 208 - 217. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. N. Kang, J. A. Jude, R. A. Panettieri Jr., T. F. Walseth, and M. S. Kannan Glucocorticoid regulation of CD38 expression in human airway smooth muscle cells: role of dual specificity phosphatase 1 Am J Physiol Lung Cell Mol Physiol, July 1, 2008; 295(1): L186 - L193. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. G. Tirumurugaan, J. A. Jude, B. N. Kang, R. A. Panettieri, T. F. Walseth, and M. S. Kannan TNF-{alpha} induced CD38 expression in human airway smooth muscle cells: role of MAP kinases and transcription factors NF-{kappa}B and AP-1 Am J Physiol Lung Cell Mol Physiol, June 1, 2007; 292(6): L1385 - L1395. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||
