AJP - Lung Fuel your research with LabChart
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Am J Physiol Lung Cell Mol Physiol 292: L654-L663, 2007. First published November 3, 2006; doi:10.1152/ajplung.00229.2006
1040-0605/07 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
292/3/L654    most recent
00229.2006v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hinton, M.
Right arrow Articles by Dakshinamurti, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hinton, M.
Right arrow Articles by Dakshinamurti, S.

Thromboxane hypersensitivity in hypoxic pulmonary artery myocytes: altered TP receptor localization and kinetics

Martha Hinton,1,3 Alex Gutsol,3 and Shyamala Dakshinamurti1,2,3

Departments of 1Physiology and 2Pediatrics, University of Manitoba, Biology of Breathing Group, and 3Manitoba Institute of Child Health, Winnipeg, Manitoba, Canada

Submitted 20 June 2006 ; accepted in final form 3 November 2006


   ABSTRACT
TOP
 ABSTRACT
METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Hypoxia-induced neonatal persistent pulmonary hypertension (PPHN) is characterized by sustained vasospasm and increased thromboxane (TxA2)-to-prostacyclin ratio. We previously demonstrated that moderate hypoxia induces myocyte TxA2 hypersensitivity. Here, we examined TxA2 prostanoid receptor (TP-R) localization and kinetics following hypoxia to determine the mechanism of hypoxia-induced TxA2 hypersensitivity. Primary cultured neonatal pulmonary artery myocytes were exposed to 10% O2 (hypoxic myocytes; HM) or 21% O2 (normoxic myocytes; NM) for 3 days. PPHN was induced in neonatal piglets by in vivo exposure to 10% FIO2 for 3 days. TP-R was studied in whole lung sections from pigs with hypoxic PPHN- and age-matched controls; intracellular localization was studied by immunocytochemistry. TP-R affinity was studied in cultured myocytes by saturation binding kinetics using 3H-SQ-29548 and competitive binding kinetics by coincubation with U-46619. Phosphorylation and coupling were examined in immunoprecipitated TP-R. We report distal propagation of TP-R expression in PPHN, extending to pulmonary arteries <50 µm. In HM, intracellular TP-R moves towards the perinuclear region, mirroring a change in endoplasmic reticulum (ER) morphology. TP-R kinetics also alter in HM membranes, with decreased Kd and Bmax (maximal binding sites). Additionally, in hypoxia, 3H-SQ-29548 is displaced at lower concentration of U-46619 than in normoxia, suggesting increased agonist affinity. Phosphorylation of serine residues on HM TP-R was significantly decreased compared with NM; this difference correlated with increased G{alpha}q coupling in hypoxia and was ablated by incubation with PKA. We conclude that the TP-R is normally desensitized in the neonatal pulmonary circuit by PKA-mediated regulatory phosphorylation, decreasing ligand affinity and coupling to G{alpha}q; this protection is lost following hypoxic exposure. Also, the appearance of TP-R in resistance arteries after development of hypoxic PPHN may contribute to increased pulmonary arterial pressure.

smooth muscle; persistent pulmonary hypertension of the newborn; Scatchard analysis

AT BIRTH, THE PULMONARY CIRCUIT must reduce its high vascular resistance to accommodate an eight-to-ten-fold increase in blood flow. This transition requires pulmonary inflation with oxygen and active vasodilation by nitric oxide (NO) and prostacyclin (PGI2) (43). One of the most rapidly progressive and potentially fatal of the vasculopathies, neonatal persistent pulmonary hypertension (PPHN) has an incidence of up to 6.8 in 1,000 live births (52). PPHN is caused in otherwise healthy term infants by interference of normal circulatory transition by perinatal hypoxia, inflammation, or direct lung injury, such as meconium aspiration (18), and is characterized by sustained vasospasm and chronic vascular remodeling (50). All etiologies of PPHN result in a critical decrease in tissue oxygen delivery (15). Approximately one-third of patients meeting treatment criteria do not respond to therapeutic agents, including inhaled NO, and in this subpopulation the disease is lethal, although rescue therapy with extracorporeal membranous oxygenation may limit mortality (9).

Hypoxic pulmonary vasoconstriction may be physiologically advantageous to bypass localized hypoventilated areas of lung. However, chronic hypoxia is a proinflammatory stimulus that induces both proliferation (56) and constriction (39) in vascular smooth muscle. It is known that alveolar hypoxia (10% O2) rapidly induces macrophage recruitment, increases vascular permeability, and enhances expression of inflammatory mediators TNF-{alpha}, NF-{kappa}B, ICAM-1, and macrophage inflammatory protein-1beta (MIP-1beta), as well as hypoxia-inducible factor-1{alpha} (HIF-1{alpha}) (28). Hypoxia also worsens lipopolysaccharide-induced injury in rat lung; the hypoxia-induced component of the inflammatory response is independently generated and localized to the respiratory compartment (49). Cyclooxygenase-2 (COX-2) upregulation in hypoxia is described in many species (27), as well as in human pulmonary arterial myocytes (58). Altered arachidonic acid metabolism with an increased thromboxane (TxA2)-to-PGI2 ratio is described early in the course of PPHN, in the neonatal piglet hypoxia model (6); this shift toward the inflammatory arachidonic acid metabolites mediates increased pulmonary vasoconstriction. Hypoxia has a priming effect on pulmonary vascular smooth muscle agonist response and increases inositol triphosphate (IP3) generation to agonist, favoring myocyte contraction (36). Long-term hypoxia can result in chronic vasospasm by decreasing K+ channel open probability and downregulating Kv channel expression (32). Although multiple downstream effects of hypoxia have been demonstrated, the intracellular sensor of O2 tension is unknown but may include ROS production and/or heme-containing proteins (20).

The major endogenous molecules that regulate pulmonary vascular tone and are pivotal in the perinatal period include the NO-endothelin and PGI2-TxA2 axes (54). A shift in the NO-endothelin ratio away from production of the vasorelaxant NO, due to decreased endothelial NO synthase expression, has been shown to contribute to the development of PPHN (48). In addition, an increased TxA2-PGI2 ratio, due to decreased PGI2 synthase production, has been described in a hypoxic model of PPHN (6). TxA2 is a constrictor prostanoid, produced via the arachidonic acid pathway in response to oxidative stress and proinflammatory stimuli, and is known to be crucial in mediating septic pulmonary hypertension in the neonate (5, 13). COX pathway metabolites are implicated in increased pulmonary vascular tone, contributing to the early pulmonary hypertensive response in meconium aspiration (41) and sepsis (13). We have previously shown that neonatal pulmonary artery myocytes exposed to a moderate level of hypoxia have hypersensitive and hyperresponsive peak [Ca2+]i responses to the TxA2 agonist U-46619, despite a reduction in cell surface TxA2 prostanoid receptor (TP-R) expression (19); this heightened response persists long after removal from hypoxia.

TxA2 binds to the TP-R, which is a member of the G protein-coupled receptor (GPCR) superfamily (23). Differential splicing of the TP-R COOH-terminal tail gives rise to the two known isoforms of TP-R, -{alpha} and -beta. Both isoforms of TP-R couple to G{alpha}q but alternatively regulate adenylate cyclase through activation by TP-R{alpha} or inhibition by TP-Rbeta (21). Signaling through G{alpha}q leads to activation of phospholipase C, which produces diacylglycerol and IP3 (33). Altered redox state of the TP-R has been shown to regulate receptor number and affinity in platelet membranes (4) and transfected cells (46). Covalent modification by phosphorylation of the TP-R alters its activity state, with phosphorylation leading to desensitization and dephosphorylation resulting in resensitization (42).

The left shift in the TxA2 dose-response curve observed following moderate hypoxic exposure suggests a probable change in TP-R kinetics, involving alteration of either receptor abundance or affinity. Whereas GPCRs are most commonly upregulated by increasing receptor abundance, the mechanism of hypoxia-induced TxA2 hypersensitivity in the neonatal pulmonary circuit has not been previously studied. In this study, we examine TP-R localization following exposure to moderate hypoxia in vivo and in vitro and detailed receptor-ligand kinetics in myocytes after in vitro hypoxia. We hypothesize that the hypersensitive TxA2 response observed following moderate hypoxic exposure is due to an increased affinity of the TP-R for agonist and that in vivo TP-R localization in the pulmonary arterial circuit is altered following development of PPHN.


   METHODS
TOP
 ABSTRACT
 METHODS
RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Animal model and induction of PPHN. All primary cell cultures were derived from newborn piglets (<24 h old; n = 13) that were killed on the day of arrival from a pathogen-free farm supplier. Lung tissue for histological analysis was obtained from pigs with hypoxia-induced PPHN (n = 4) or from age-matched controls (n = 4). This study protocol was reviewed and approved by an institutional review board following Canadian Council on Animal Care guidelines. The in vivo hypoxic model has been previously described (8). Briefly, newborn piglets were placed in a normobaric hypoxic chamber (FIO2 0.10, achieved by a mixture of room air with N2) for 3 days. All piglets were euthanized by pentobarbital overdose and exsanguination. Heart and lungs were removed en bloc and placed in oxygenated, cold (4°C) Ca2+-free Krebs-Henseleit physiological buffer (containing in mM: 112.6 NaCl, 25 NaHCO3, 1.38 NaH2PO4, 4.7 KCl, 2.46 MgSO4, 7 H2O, and 5.56 dextrose, pH 7.4). Right ventricular afterloading was determined by relative cardiac weight ratio (blotted tissue weight, right ventricle to left ventricle plus septum) to diagnose development of PPHN (19).

Immunohistochemistry. Lung tissue was paraffin-embedded and cut into 5-µm sections, which were then deparaffinized in xylene for 20 min followed by stepwise rehydration in ethanol solutions. Formalin cross-links were removed by boiling sections in a 5 mM sodium citrate and 2 mM citric acid solution. Nonspecific antibody binding was blocked by preincubation with 10% donkey serum in Cyto-TBS+1%BSA (containing in mM: 20 Tris base, 154 NaCl, 2 EGTA, 2 MgCl2, pH 7.4) for 20 min at room temperature in a humidified chamber. Sections were then incubated with rabbit-anti-TP-R antibody (Chemicon International) and mouse-anti-myosin heavy chain antibody (used to visualize small arteries; Abcam, Cambridge, MA) overnight at 4°C, followed by incubation with FITC-conjugated donkey anti-rabbit antibody and indocarbocyanine (Cy3)-conjugated donkey anti-mouse antibody. Sections were then mounted with antifade and visualized by fluorescent microscopy. Intensity of TP-R immunohistochemical staining was quantified in all images, employing a constant region of interest radius method, using mean intensity from a minimum of 20 regions of interest for each artery. The luminal surface of all arteries was excluded from analysis to avoid interference signal from platelets.

Cell culture. Pulmonary artery smooth muscle cells (PASMC) were obtained from newborn pigs using a dispersed cell culture method selective for myocytes (40). Third to sixth generation pulmonary arteries were obtained by microdissection into Ca2+-free Krebs-Henseleit physiological buffer and were allowed to recover in cold HEPES-buffered saline solution (HBS; composition in mM: 130 NaCl, 5 KCl, 1.2 MgCl2, 1.5 CaCl2, 10 HEPES, 10 glucose, pH 7.4) supplemented with an antibiotic/antimycotic mixture and gentamicin. Arteries were then washed twice with Ca2+-reduced HBS (20 µM CaCl2) and finely minced. Arterial tissue was transferred to a digestion solution containing Ca2+-reduced HBS, type I collagenase (1,750 U/ml), dithiothreitol (1 mM), BSA (2 mg/ml), and papain (9.5 U/ml) for 15 min at 37°C with gentle agitation. Dispersed PASMCs were collected by centrifugation at 1,200 rpm for 5 min, washed in Ca2+-free HBS to remove digestion solution, and then resuspended in culture medium.

The cells were plated at a density of 4.4 x 104 cells/cm2 in Ham's F-12 medium with L-glutamine supplemented with 10% fetal calf serum, 1% penicillin, and 1% streptomycin. Cells were serum-deprived for 2 days once they reached confluence (in Ham's F-12 medium with L-glutamine/penicillin/streptomycin and 1% insulin-transferrin-selenium) to synchronize cells in a contractile phenotype and then split into two groups for the final 3 days of culture: 1) control normoxic myocytes (NM), maintained serum-free in 21% O2, 5% CO2; and 2) hypoxic myocytes (HM), maintained serum-free in 10% O2, 5% CO2 for 3 days to mimic the extent and duration of the in vivo O2 exposure.

Immunocytochemistry. PASMCs were fixed with 3% paraformaldehyde for 15 min at room temperature followed by permeabilization with 0.3% Triton X-100 for 5 min. Cells were rinsed twice with common base buffer (containing in mM: 10 MES, 150 NaCl, 5 EGTA, 5 MgCl2, 5 glucose) and stored in Cyto-TBS at 4°C. Nonspecific binding was blocked by incubation with 10% normal donkey serum in Cyto-TBS+1%BSA for 20 min at room temperature. PASMCs were then incubated with TP-R rabbit polyclonal antibody (Cayman Chemicals, Ann Arbor, MI) overnight at 4°C, followed by incubation with FITC-conjugated donkey anti-rabbit antibody for 2 h at room temperature. Coverslips were coincubated with either mouse anti-golgin-97 (a Golgi apparatus-specific marker; Molecular Probes, Eugene, OR) or mouse anti-protein disulfide isomerase [PDI; an endoplasmic reticulum (ER)-specific marker; Stressgen Bioreagents, Victoria, British Columbia, Canada], which was followed by coincubation with Cy3-conjugated donkey anti-mouse antibody. Nuclei were counterstained with Hoechst 33342.

Fluorescence immunocytochemistry images were acquired using an Olympus 1X 70 microscope with an UltraPix FSI digital camera and analyzed with UltraView software (PerkinElmer).

RT-PCR. RNA was extracted from frozen PASMCs using TRIzol (Invitrogen) according to the manufacturer's instructions. Briefly, cells were homogenized in TRIzol reagent. Chloroform was added, and samples were centrifuged at 12,000 g for 15 min at 4°C. The resulting aqueous solution was incubated in isopropyl alcohol for 10 min at 30°C. The RNA pellet was isolated by centrifuging at 8,000 g for 10 min at 4°C and washed with 75% ethanol. RNA was redissolved in diethyl pyrocarbonate-treated water at 55°C for 30 min. RNA purity was determined using a spectrophotometer. Two micrograms of total RNA was reverse transcribed using the Omniscript RT kit (Qiagen) in a total reaction volume of 20 µl in the presence of 1 µg oligo(dT)-15 primers (Promega) and 10 units of RNasin ribonuclease inhibitor (Promega) following the manufacturer's instructions.

TP-R primers were used as previously published (1): sense primer 5'-331CTGGTCCT CACCGACTTCCT350-3', antisense primer 5'-525GATACCCAGGTAGCGCTCTG506-3' for an estimated product size of 200 base pairs. The reaction mixture contained 10x PCR buffer (2.5 µl), 10 mM dNTP (0.5 µl), 50 mM MgCl2 (0.75 µl), 10 µM sense primer (0.5 µl), 10 µM antisense primer (0.5 µl), platinum Taq (0.125 µl), water (18.125 µl), and 2 µl sample cDNA. PCR amplifications were carried out using a Techne Genius Unit with the following conditions: denaturation and enzyme activation at 94°C for 5 min, a total of 40 amplification cycles consisting of a 30-s denaturation at 94°C, 30-s annealing step starting at 60°C and then decreasing by 0.5°C increments per cycle until 52°C, followed by a 30-s extension at 72°C. The final extension was at 72°C for 5 min.

Pig GAPDH primers used were previously published (44): sense primer 5'-TTCCACGGCACAGTCAA-3', antisense primer 5'-GCAGGTCAGGTCCACAA-3', for an estimated product size of 576 base pairs. The reaction mixture contained 10x PCR buffer (3.75 µl), 10 mM dNTP (1 µl), 2.5 µM sense primer (0.5 µl), 2.5 µM antisense primer (0.5 µl), water (18.125 µl), platinum Taq (0.125 µl), and 1 µl of sample cDNA. PCR amplifications were carried out in the following conditions: denaturation and enzyme activation for 5 min at 95°C, 33 amplification cycles consisting of 30-s denaturation at 94°C, 45-s annealing phase at 55°C, and 45-s extension phase at 72°C, with final extension held for 5 min.

PCR products were separated by 1% agarose gel electrophoresis and visualized with GelStar. Bands were analyzed by densitometry, with TP-R normalized to GAPDH.

TxA2 receptor kinetics. PASMCs were rinsed free of culture medium with PBS. Whole cell lysates were obtained by scraping cells in binding buffer (containing in mM: 25 Tris, 10 CaCl2, 0.01 indomethacin, pH 7.4) and 75 µg/ml PMSF. Unlysed cells and large particulate matter were separated by centrifugation at 1,000 g for 5 min and discarded. The supernatant was ultracentrifuged at 75,000 g for 60 min at 4°C, after which the membrane fraction was resuspended in binding buffer. Protein concentration in the membrane fraction was measured using the Bio-Rad method. One hundred micrograms membrane protein was used for all radioligand experiments.

Saturation-binding kinetics. Samples were incubated with 3H-SQ-29548 ranging from 0 nM to 70 nM (diluted in binding buffer) in 100 µl total reaction volume for 1 h at room temperature. Reactions were terminated by vacuum filtration, and membranes were washed twice with ice-cold binding buffer. Filters were agitated in 500 µl of distilled water to release absorbed radioisotope and were allowed to equilibrate in 5 ml of CytoScint (ICN) for at least 5 h before counting. Unbound radioisotope was also collected. Counts per minute were analyzed for 10 min per sample.

Competitive binding analysis. The molecule used to study TP-R saturation kinetics was an antagonist, but the desired receptor-ligand interaction for study involved the agonist, which may have a different binding site or conformation on the TP receptor than the antagonist and thus very different kinetics. Accordingly, competitive binding analyses were carried out against both the unlabeled SQ29548 (a TP-R antagonist) and U-46619 (a TP-R agonist). Membrane samples were incubated with 10 nM 3H-SQ-29548 and unlabeled ligand ranging in concentration from 0.1 nM to 100 µM for 1 h at room temperature.

Immunoprecipitation. Whole cell lysates were collected in RIPA buffer modified for phospho-protein analysis (containing in mM: 20 MOPS, 2 EGTA, 5 EDTA, 30 sodium fluoride, 40 beta-glycerophosphate, 10 sodium pyrophosphate, 2 sodium orthovanadate, 1 PMSF, 3 benzamidine, 0.005 pepstatin A, 0.01 leupeptin). A 50% slurry of protein G Sepharose beads was prepared in lysis buffer (containing in mM: 50 Tris, 150 NaCl, 1 EDTA, 1 PMSF, and 1% Triton X-100, pH 7.4). Lysate (500 µg) was then precleared by incubation with 35 µl of 50% bead slurry in a total volume of 250 µl. Beads were isolated by centrifugation at 16,000 g for 5 min. The precleared lysate was then added to 2 µg of rabbit-TP-R antibody (Cayman Chemicals) overnight at 4°C. Thirty microliters of 50% bead slurry was then added to pull down the immunoprecipitate. Beads were washed with lysis buffer and boiled in Laemmli buffer for 10 min; the protein derived was separated by SDS-PAGE and probed with mouse-anti-phosphoserine antibody (Qiagen) and rabbit-anti-G{alpha}q antibody (Santa Cruz Biotechnology).

To determine the signaling pathway involved in hypoxia-induced TP-R desensitization, PASMCs were incubated with 1 µM PMA (phorbol 12-myristate 13-acetate; a PKC activator) and 10 µM forskolin (a PKA activator) for the final 3 days of culture. In a separate experiment, 1 µM GTP{gamma}S (a stable GTP analog) was added to lysates during antigen-antibody incubation to maximize receptor active state conformation. TP-R phosphorylation on serine residues was then studied in all groups as described above.

Live cell calcium mobilization. Live cell calcium imaging was carried out as previously described (19). Control PASMCs or cells treated with 1 µM PMA, 10 µM forskolin, or 1 µM GTP{gamma}S (as described in Immunoprecipitation) were loaded with 5 µM fura 2-AM (Molecular Probes)/DMSO in HBSS (containing in mM: 1.26 CaCl2, 0.493 MgCl2·6 H2O, 0.407 MgSO4·7 H2O, 5.33 KCl, 0.441 KH2PO4, 4.17 NaHCO3, 137.93 NaCl, 0.338 NaHPO2, and 0.1% BSA) with 1.0 µg/ml pluronic acid as per manufacturer's instructions. Cover glass plates were secured on an inverted microscope (Olympus) in room air and studied at x20 magnification. Real-time ratiometric imaging of intracellular calcium concentration used excitation wavelengths of 340 and 380 nm and an emission wavelength of 510 nm; data was captured by a charge-coupled device camera and Perkin Elmer software. Each recording consisted of a stable baseline and a response to 1 µM U-46619. PMA, forskolin, and GTP{gamma}S were omitted during fura 2-AM loading but were present at the time of recording.

Statistical analysis. All data are presented as means ± SE and analyzed using an unpaired t-test with P < 0.05 considered significant.


   RESULTS
TOP
 ABSTRACT
 METHODS
 RESULTS
DISCUSSION
 GRANTS
 REFERENCES
 
Development of pulmonary hypertension was diagnosed by increased right-to-left ventricle plus septum weight ratio. Newborn piglets had a ratio of 0.709 ± 0.108 g, which decreased in control 3-day-old pigs with a ratio of 0.573 ± 0.221 g. However, this ratio was elevated in 3-day animals with hypoxic PPHN (0.877 ± 0.166 g; different from 3-day normoxic controls, P < 0.05), mainly due to an increase in right ventricular weight.

Immunohistochemical analysis of lung slices from pigs with hypoxic PPHN- and age-matched controls revealed that large arteries expressed similar levels of TP-R (Fig. 1, A and B). However, in pulmonary arteries <50 µm in diameter, TP-R was not observed in control animals, whereas signal was detected in animals with hypoxic PPHN (Fig. 1C). Quantification of TP-R intensity in the smaller caliber pulmonary arteries showed a statistically significant increase in TP-R intensity in lung slices from pigs with PPHN, with TP-R probe intensity from control arteries composed largely of background signal (Fig. 1D; P < 0.0001).


Figure 1
View larger version (44K):
[in this window]
[in a new window]

  		Fig. 1. Thromboxane receptor expression in large and small arteries: representative pictures of paraffin-embedded lung sections showing arteries >80–100 µm in diameter (A) and arteries between 10 and 50 µm in diameter (C) from 3-day-old control pigs and 3-day-old pigs with hypoxia-induced neonatal persistent pulmonary hypertension (PPHN) colabeled with mouse-anti-myosin heavy chain to identify arteries (red) and rabbit-anti-thromboxane receptor (green). The white bars represent 10 µm for that picture. Thromboxane prostanoid receptor (TP-R) probe intensity was quantified in arbitrary units for large (B; n = 10; P = not significant) and small pulmonary arteries (D; n = 14; *P < 0.0001).

 
We have previously demonstrated decreased cell surface immunostaining for TP-R and intracellular redistribution of TP-R following moderate hypoxic exposure (19). In this study, TP-R colocalization with golgin-97 (a marker for the Golgi apparatus; Fig. 2B) was not different between HM and NM. However, the relocation of TP-R in HM to the perinuclear region seemed to mirror a shift in PDI signal (a marker for the ER; Fig. 2A). Quantification of PDI signal showed that immunostaining intensity in the perinuclear region was increased in HM compared with NM (Fig. 2C; HM = 1.06 ± 0.01 arbitrary units, NM = 1.00 ± 0.01 arbitrary units, 25 equal regions selected per microscope field image, n = 10; P < 0.0001). Total cell area containing PDI signal, normalized to number of nuclei per image, was slightly, but not significantly, decreased (Fig. 2D; HM = 0.91 ± 0.03 arbitrary units, NM = 1.00 ± 0.07 arbitrary units, n = 10; P = not significant).


Figure 2
View larger version (43K):
[in this window]
[in a new window]

  		Fig. 2. Subcellular thromboxane receptor localization: permeabilized pulmonary artery smooth muscle cells (PASMCs) colabeled with rabbit-anti-TP-R (green) and mouse-anti-protein disulfide isomerase (PDI; red) (A), and rabbit-anti-TP-R (green) and mouse-anti-golgin-97 (red) (B). Nuclei were counterstained with Hoechst (blue), and all images were captured at x100 magnification. Analysis of perinuclear PDI intensity (C) and area normalized to number of nuclei (D); *P < 0.0001; n = 10 images. NM, normoxic myocytes; HM, hypoxic myocytes.

 
There was no significant difference in total TP-R expression as measured by RT-PCR in HM compared with NM after normalization to GAPDH (Fig. 3).


Figure 3
View larger version (11K):
[in this window]
[in a new window]

  		Fig. 3. Thromboxane receptor expression: RT-PCR was carried out using primers designed to examine TP-R expression, irrespective of isoform. Bands obtained were normalized to GAPDH expression. TP-R expression levels were not significantly different between HM (n = 5) and NM (n = 5); P = not significant.

 
Saturation binding experiments revealed a decrease in TP-R abundance in membrane fractions from HM compared with NM [Table 1; NM Bmax (maximal binding sites) = 610.30 ± 270.60 fmol/mg, HM Bmax = 150.80 ± 32.35 fmol/mg; P < 0.001]. HM TP-R also had an increased affinity for the TP-R antagonist, SQ29548 (Table 1; NM Kd = 72.97 ± 46.40 nM, HM Kd = 12.74 ± 7.72 nM; P < 0.03).


View this table:
[in this window]
[in a new window]

  		Table 1. Thromboxane receptor saturation binding kinetics

 
Competitive binding experiments, where unlabeled SQ29548 was used to displace 3H-SQ-29548 binding, indicated a significantly right-shifted dose-response curve in HM (Fig. 4A; NM IC50 = 1.13 x 10–7 ± 0.37 M, HM IC50 = 1.17 x 10–6 ± 0.01 M; P < 0.01). Membrane fractions coincubated with 3H-SQ-29548 and the unlabeled TxA2 agonist U-46619 revealed a significantly left-shifted binding curve for U-46619 in HM (Fig. 4B; NM IC50 = 5.47 x 10–9 ± 0.22 M, HM IC50 = 4.66 x 10–10 ± 0.18 M; P < 0.005).


Figure 4
View larger version (7K):
[in this window]
[in a new window]

  		Fig. 4. Competitive binding kinetics: 100 µg of PASMC membrane was incubated with 10 nM 3H-SQ-29548 and a range of concentrations of unlabeled TP-R antagonist (SQ29548; A) or unlabeled TP-R agonist (U-46619; B). The IC50 values for HM and NM were significantly different in both cases (A, P < 0.01; B, P < 0.005). Data were obtained from cell lysates from 13 animals, and experiments were performed 3 times.

 
We have previously reported that normoxic and hypoxic whole cell lysates have similar TP-R protein abundance (19). Analysis of whole cell TP-R immunoprecipitate with antibody to phosphoserine revealed that HM TP-R was significantly less phosphorylated relative to NM TP-R (Fig. 5A; P < 0.003; n = 5). Conversely, immunoblot of the TP-R immunoprecipitate with a G{alpha}q antibody indicated a greater association of HM TP-R with G{alpha}q than was the case for NM TP-R (Fig. 5B; P < 0.03; n = 3). The immunoprecipitates contained similar amounts of TP-R (Fig. 5C; P = not significant; n = 4).


Figure 5
View larger version (14K):
[in this window]
[in a new window]

  		Fig. 5. Thromboxane receptor coimmunoprecipitation: the immunoprecipitate obtained by HM and NM whole cell lysate incubation with a TP-R antibody was probed with mouse-anti-phosphoserine (P-serine) antibody (A) or rabbit-anti-G{alpha}q antibody (B). HM had significantly less phosphorylation of TP-R than NM (A; *P < 0.003; n = 5), whereas HM TP-R was associated significantly more with G{alpha}q protein (B; #P < 0.03; n = 3). C: the relative amount of TP-R precipitated by whole lysate incubation was not significantly different between NM and HM (P = not significant; n = 4).

 
The elevated phosphorylation state of the NM TP-R compared with HM TP-R was maintained following immunoprecipitation in the presence of GTP{gamma}S, used to ensure maximal receptor activation (Fig. 6, A and B; P < 0.03; n = 3). Incubation with PMA (a PKC activator) increased TP-R serine phosphorylation in the hypoxic group alone (Fig. 6, A and B; P < 0.04; n = 3). However, following incubation with forskolin (a PKA activator), there was a significantly higher level of phosphorylation of both NM and HM TP-R, ablating any difference in receptor phosphorylation between the two groups (P = not significant; n = 3).


Figure 6
View larger version (17K):
[in this window]
[in a new window]

  		Fig. 6. Regulation of thromboxane receptor phosphorylation by G protein activation, PKC and PKA: hypoxic (HM) and normoxic (NM) pulmonary arterial myocytes were preincubated with 1 µM GTP{gamma}S (to induce maximal active state conformation of G protein-coupled receptor), 1 µM PMA (activating protein kinase C), or 10 µM forskolin (activating protein kinase A), and then TP-R immunoprecipitated to study regulatory receptor phosphorylation and signaling. A: TP-R phosphorylation on serine residues was studied on TP-R immunoprecipitate. HM TP-R was significantly less phosphorylated than NM TP-R under control and GTP{gamma}S conditions (*P < 0.03; n = 3). HM TP-R was more phosphorylated after treatment with PMA (#P < 0.04; n = 3). However, the difference between HM and NM was ablated following forskolin treatment (P = not significant; n = 3). B: representative TP-R immunoprecipitate, probed with mouse-anti-phosphoserine antibody. C: peak [Ca2+]i response, measured using fura 2-AM, remained elevated in PASMC exposed to moderate hypoxia in the presence of GTP{gamma}S and PMA but was ablated when incubated with forskolin (*P < 0.01; n = 16).

 
As previously observed, PASMC exposed to 10% O2 for the final 3 days of culture resulted in an elevated peak [Ca2+]i response to 1 µM U-46619 (19). Incubation of both HM and NM with GTP{gamma}S had no effect on peak calcium response to 1 µM U-46619, and the hypoxia-induced elevation in agonist response was maintained (Fig. 6C; NM = 1.088 ± 0.224 µM, HM = 2.142 ± 0.155 µM, n = 16; P < 0.01). The hyperresponsiveness of the HM was also maintained following incubation with PMA (Fig. 6C; NM = 1.177 ± 0.185 µM, HM = 2.253 ± 0.228 µM, n = 16; P < 0.01). In contrast, forskolin markedly inhibited the hypoxia-induced increase in peak calcium response to 1 µM U-46619 (Fig. 6C; NM = 0.513 ± 0.099 µM, HM = 0.630 ± 0.056 µM; P = not significant).


   DISCUSSION
TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
GRANTS
 REFERENCES
 
In this study, we examined the effect of moderate hypoxia on TP-R localization and kinetics in a neonatal PASMC culture model of hypoxic pulmonary hypertension to determine the mechanism by which these cells become hypersensitive to a TxA2 agonist. We determined that TP-R localization is altered both in an in vivo model of hypoxia-induced PPHN, as well as in pulmonary artery myocytes exposed to moderate hypoxia in vitro. After whole animal hypoxia, TP-R appeared in smaller caliber pulmonary arteries where normally TP-R is not expressed. In HM, there was an intracellular shift in TP-R distribution that followed a change in ER distribution. We also observed increased TP-R binding affinity, decreased receptor phosphorylation of serine residues, and an increased coupling to the G{alpha}q protein in pulmonary arterial smooth muscle following hypoxic exposure. Lastly, we found that forskolin treatment increased TP-R phosphorylation in HM and reduced agonist-induced peak [Ca2+]i response back to control levels.

In discussing these data, we acknowledge certain limitations in application of the in vitro hypoxia model to the pathophysiology of hypoxic PPHN in vivo. In previous studies, we have established that a comparable degree of TP receptor sensitization occurs under in vitro hypoxic exposure as in vivo. Our original cellular investigations of TP-R sensitization mechanisms dealt largely with primary cultured pulmonary arterial myocytes using in vitro hypoxia, as does the present study. Advantages of this approach include that the hypoxic exposure is proximal to the point of experimentation, whereas in our in vivo model, up to 2 wk of normoxic cell culture intervened between exposure and experiment. When examining temporally sensitive effects of hypoxia on cell surface receptor regulation, the use of serum-starved primary culture myocytes exposed to hypoxia immediately prior to experiment permits more mechanistic investigation, while still fairly representative of the myocyte population of the hypoxic pulmonary vascular wall.

Altered TP-R expression. An increase in TxA2 production, in conjunction with an increase in COX-2 abundance, has been described in the piglet model of hypoxia-induced PPHN (38). Others have reported an increase in TxA2 following septic induction of PPHN in the piglet (13). Additionally, TP-R activation, although not through action of TxA2, has been shown to be involved in the increase in endothelin-1 in the rat model of neonatal PPHN (22). Altered receptor abundance for TxA2 has not been previously characterized in hypoxia. In this study, we observed an increase in TP-R expression in small caliber pulmonary arteries. The histology of end-stage pulmonary hypertension is well characterized by thickened vascular media and adventitia, hyperplasia and hypertrophy of the vascular smooth muscle layer, and increased extracellular matrix deposition (30), impairing vascular dispensability (45) and eventually resulting in a fixed and irreversible increase in pulmonary vascular resistance. In vivo hypoxia clearly also results in distal propagation of TP-R expression, such that 10–50-µm diameter arteries accrue receptors capable of responding to circulating TxA2. Thus, whereas under normal conditions, only pulmonary arteries 100 µm in diameter or larger may be responsible for TxA2 agonist-induced vasoconstriction, after development of PPHN, smaller arteries become capable of contributing to agonist response and overall PA pressure. It should be noted that this immunohistochemistry data indicates whole cell TP-R expression, not cell surface expression, and the latter decreases under in vitro hypoxia. Both control and hypoxic cultured pulmonary artery myocytes expressed TP-R, as indicated by RT-PCR. The pulmonary arteries microdissected for the primary culture preparation contained a mixture of larger and smaller vessels (3rd to 6th generation intrapulmonary branches). As smaller vessels have greater muscular content, the majority of cultured myocytes derive from the smaller arteries. Both control and hypoxic cultured pulmonary artery myocytes abundantly expressed TP-R, as shown by RT-PCR. Expression of TP-R in normoxia may have been simply induced under cell culture conditions, or may reflect contribution from smooth muscle cells from larger arteries, as vessel size had an important impact on TP-R expression in our study. Therefore, a limitation in interpretation of this study is that altered regulation of TP-R observed in cultured myocytes may not be entirely representative of TP-R alterations in vivo, depending on the original location of the studied TP-R within the arterial tree.

TP-R intracellular localization. We have previously shown that moderate hypoxic exposure alters TP-R localization following in vitro hypoxia for 3 days, with decreased cell surface expression and a translocation of the intracellular receptor to the perinuclear region (19). Cell surface receptor abundance is known to be modulated by internalization and ER-associated degradation (47). Agonist-induced internalization of the TP receptor is mediated by G{alpha}q signaling (38). In the context of an increased TxA2: PGI2 milieu and increased receptor affinity, TP-R internalization in hypoxia may constitute a negative feedback mechanism attenuating vasoconstrictor response. In this study, we also observed that the ER relocates to a perinuclear position in HM, although this change was numerically small. There is precedent for this observation: a reduction in smooth ER has been described in rat hepatocytes following exposure to 5% environmental O2 (55). The admittedly minor (albeit statistically significant) change in the ER morphology of HM may explain the observed shift in intracellular TP-R distribution, which may impact on receptor internalization and cycling. Observations reported elsewhere of altered TP-R localization following oxidative stress, involving stabilization of the TP-R and translocation from the ER to the Golgi apparatus following exposure to H2O2 (46), describe a change in cell surface receptor immunostaining within this range. A three-dimensional analysis of ER distribution ascribes functional specialization of protein import machinery to ER lamellae organized a few nanometers apart (11), suggesting small differences in ER distribution may confer significant changes of function. Luminal ER protein chaperones such as PDI (used in this study as an ER marker) function as protein escorts, hence minor alterations in localization of this protein may have functional significance (26, 31). The slight shift in ER distribution we observe in HM may alter receptor cycling, posttranscriptional modification, and/or compartmentalization, which would impact on cell surface abundance and activity of the TP-R, as we report is the case in HM.

TP-R binding kinetics. Published values of SQ29548 binding to TP-R range from a Kd of 6.3 nM (46) to 1.72 nM (16). The Kd value we obtained for HM was comparable to previously reported values, whereas the NM Kd was relatively elevated, suggesting that the NM TP-R is relatively desensitized. The Bmax was also decreased in HM TP-R compared with NM, supporting our previous observation by immunocytochemistry (19). After observing an alteration in both TP-R abundance and binding affinity following hypoxic exposure, it was necessary to examine competitive binding kinetics. As the desired receptor-ligand interaction involved the agonist rather than the available radiolabeled antagonist, the competitive binding analysis was carried out against both unlabeled SQ29548 (a TP-R antagonist) and unlabeled U-46619 (a TP-R agonist). Published values of SQ29548 binding to TP-R range from a Kd of 6.3 nM (47) to 1.72 nM (16). In NM, unlabeled SQ29548 had a lower IC50, suggesting increased affinity for antagonist in the normal condition compared with hypoxic cells, a finding inconsistent with that observed in saturation binding experiments; this may have been an artifact of the greater cell surface receptor abundance (Bmax) in NM, leading to increased availability of open receptor for binding. However, unlabeled U-46619 displaced the 3H-SQ-29548 in HM at significantly lower concentrations, suggesting that the hypoxic receptor has increased affinity for the agonist; this observation supports the saturation binding kinetics. The difference in agonist/antagonist displacement of the labeled antagonist may be due to the consistently lower Kd of SQ29548 compared with the Kd for U-46619 (29). Since it is only activation of the TP-R by U-46619 that leads to increased [Ca2+]i and subsequent smooth muscle contraction, the significance of the competitive binding data lies in the clear indication that the hypoxic TP-R has an increased affinity for the agonist.

TP-R phosphorylation. The two known isoforms of mammalian TP receptor share the first 328 residues but differ at the COOH-terminal end (34); TP isoform may determine specificity of interaction with G{alpha} protein subunits, but both couple to PLC similarly, and no major differences in ligand affinity have been identified (2). Both TxA2 receptor isoforms are regulated by COOH-terminal serine phosphorylation (12). TP{alpha} is phosphorylated and desensitized by pulmonary circuit relaxants (37). Upon agonist-induced COOH-terminal phosphorylation, the TPbeta isoform is amenable to beta-arrestin binding (35), which results in desensitization, uncoupling from heterotrimeric G protein, and actin-dependent receptor endocytosis (25). When oligomerized with TPbeta, TP{alpha} will also undergo endocytosis (24). In this study, phosphorylation state of the normoxic TP-R was elevated compared with hypoxic TP-R. The hypoxic TP-R had increased association with G{alpha}q compared with normoxic TP-R, suggesting that downstream contractile signaling in hypoxic TP-R may be augmented compared with the relatively desensitized normoxic TP-R. As this dephosphorylation of hypoxic TP-R occurred in the context of increased receptor internalization, we speculate that TP-R internalization may represent receptor cycling as a consequence of increased TxA2 production, receptor sensitization, and/or downstream signaling in hypoxia, whereas decreased TP-R phosphorylation state may be mediated by the contrary loss of vasorelaxant stimulation in HM.

Regulation of TP-R phosphorylation. Covalent modification of various GPCRs has been shown to regulate their activity due to alterations in active state conformation or to regulatory phosphorylation. Activity of smooth muscle TP-R is primarily regulated by serine phosphorylation. Ser331 on the COOH-terminal TP-R tail is known to be phosphorylated by PKC, resulting in desensitization (57). There is evidence that TP{alpha}, but not TPbeta, may be subject to cross-desensitization mediated by prostaglandin D2 receptor (DP), and occurring via direct PKA-mediated phosphorylation of TP{alpha} at Ser329 after DP stimulation (10). Signaling by TP{alpha}, but not TPbeta, is also subject to PGI2-induced desensitization (via IP-prostanoid receptor stimulation) mediated by PKA phosphorylation of Ser329 (51). An independent mechanism of TP-R desensitization involves direct PKG phosphorylation of Ser331 in response to NO (37). Hypoxia causes sensitization of the TP-R in neonatal pulmonary artery myocytes, but under control conditions, the TP-R is relatively desensitized due to regulatory phosphorylation. TP-R phosphorylation and peak [Ca2+]i response to agonist is unaffected by GTP-induced increase in active state conformation, as maximal activation of the TP-R had no effect on phosphorylation state of the receptor, and peak [Ca2+]i response to TxA2 agonist remained significantly elevated in HM. PKC activation increases HM TP-R phosphorylation; however, the [Ca2+]i response to U-46619 remained elevated compared with normoxic controls, suggesting that in neonatal pulmonary artery myocytes, PKC may target residues with no direct effect on receptor-induced Ca2+ signaling. Incubation with a direct activator of PKA resulted in markedly increased TP-R phosphorylation, ablating the difference between hypoxia and normoxia. PKA activation also inhibited the hypoxia-induced increase in peak [Ca2+]i response to U-46619, suggesting that PKA-targeted serine residues on TP-R are involved in normoxic desensitization of TP-R.

Protein phosphatases PP1 and PP2A are implicated in TP-R dephosphorylation (42). We have previously reported a decrease in PP1M (myosin phosphatase) activity in hypoxic neonatal pulmonary artery; PP2 activity was not altered (3). This has also been reported in hypoxic PA myocytes (53). The mechanism by which TP-R is dephosphorylated in hypoxia falls outside the scope of this paper but deserves further study.

We conclude that hypoxia in the perinatal pulmonary circuit causes: distal propagation of TxA2 receptor expression; increased TP-R agonist affinity despite a decrease in Bmax resulting from increased receptor internalization; and a loss of basal TP-R phosphorylation, resulting in increased coupling of the receptor complex to vasoconstrictor signaling intermediates. We speculate that, under normal conditions in the pulmonary circuit, the neonatal TP-R is relatively desensitized compared with the adult TP-R due to increased serine residue phosphorylation. This may be physiologically advantageous, as pulmonary arteries would be less able to constrict in response to circulating TxA2 and therefore would not hinder normal circulatory transition. However, after exposure to hypoxia, TP-R appears in smaller pulmonary arteries and becomes dephosphorylated, which increases its affinity for TxA2 agonist U-46619 and increases coupling to G{alpha}q. Regulatory phosphorylation of TP-R in the neonatal pulmonary circuit may be mediated via the PKA pathway; PKA activation results in TP-R phosphorylation and can inhibit development of hypoxia-induced TP-R hypersensitivity. Altered TP-R localization and kinetics in HM may result in inflammatory agonist hypersensitivity in resistance level pulmonary arteries, which would contribute to the increased pulmonary arterial pressure observed in PPHN and could interfere with current PPHN therapies.


   GRANTS
TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
REFERENCES
 
Research was funded by grants from Manitoba Medical Services Foundation and Manitoba Institute of Child Health. M. Hinton is supported by a Canadian Institute for Health Research graduate studentship, and S. Dakshinamurti by New Investigator funding from Winnipeg Rh Institute Foundation.


   ACKNOWLEDGMENTS
 
We thank Dr. Andrew Halayko for the generous donation of G{alpha}q antibody.


   FOOTNOTES
 

Address for reprint requests and other correspondence: S. Dakshinamurti, Section of Neonatology, WS012 Women's Hospital 735 Notre Dame Ave., Winnipeg, Manitoba, Canada R3A 1R9 (e-mail: dakshina{at}cc.umanitoba.ca)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


   REFERENCES
TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 

  1. Alzoghaibi MA, Walsh SW, Willey A, Yager DR, Fowler AA 3rd, Graham MF. Linoleic acid induces interleukin-8 production by Crohn's human intestinal smooth muscle cells via arachidonic acid metabolites. Am J Physiol Gastrointest Liver Physiol 286: G528–G537, 2004.[Abstract/Free Full Text]
  2. Becker KP, Garnovskaya M, Gettys T, Halushka PV. Coupling of thromboxane A2 receptor isoforms to G{alpha}13: effects on ligand binding and signalling. Biochim Biophys Acta 1450: 288–296, 1999.[Medline]
  3. Dakshinamurti S, Mellow L, Stephens NL. Regulation of pulmonary arterial myosin phosphatase activity in neonatal circulatory transition and in hypoxic pulmonary hypertension: a role for CPI-17. Pediatr Pulmonol 40: 398–407, 2005.[CrossRef][ISI][Medline]
  4. Dorn GW 2nd. Cyclic oxidation-reduction reactions regulate thromboxane A2/prostaglandin H2 receptor number and affinity in human platelet membranes. J Biol Chem 265: 4240–4246, 1990.[Abstract/Free Full Text]
  5. Ermert M, Kuttner D, Eisenhardt N, Dierkes C, Seeger W, Ermert L. Cyclooxygenase-2-dependent and thromboxane-dependent vascular and bronchial responses are regulated via p38 mitogen-activated protein kinase in control and endotoxin-primed rat lungs. Lab Invest 83: 333–347, 2003.[ISI]
  6. Fike CD, Kaplowitz MR, Pfister SL. Arachidonic acid metabolites and an early stage of pulmonary hypertension in chronically hypoxic newborn pigs. Am J Physiol Lung Cell Mol Physiol 284: L316–L323, 2003.[Abstract/Free Full Text]
  7. Fike CD, Pfister SL, Kaplowitz MR, Madden JA. Cyclooxygenase contracting factors and altered pulmonary vascular responses in chronically hypoxic newborn pigs. J Appl Physiol 92: 67–74, 2002.[Abstract/Free Full Text]
  8. Finer NN, Barrington KJ. Nitric oxide for respiratory failure in infants born at or near term. Cochrane Database Syst Rev: CD000399, 2001.
  9. Foley JF, Kelley LP, Kinsella BT. Prostaglandin D2 receptor-mediated desensitization of the alpha isoform of the human thromboxane A2 receptor. Biochem Pharmacol 62: 229–239, 2001.[CrossRef][ISI][Medline]
  10. Geuze HJ, Murk JL, Stroobants AK, Griffith JM, Kleijmeer MJ, Koster AJ, Verkleij AJ, Distel B, Tabak HF. Involvement of the endoplasmic reticulum in peroxisome formation. Mol Biol Cell 14: 2900–2907, 2003.[Abstract/Free Full Text]
  11. Habib A, Vezza R, Creminon C, Maclouf J, FitzGerald GA. Rapid, agonist-dependent phosphorylation in vivo of human thromboxane receptor isoforms. Minimal involvement of protein kinase C. J Biol Chem 272: 7191–7200, 1997.[Abstract/Free Full Text]
  12. Hammerman C, Komar K, Abu-Khudair H. Hypoxic vs septic pulmonary hypertension. Selective role of thromboxane mediation. Am J Dis Child 142: 319–325, 1988.[Abstract]
  13. Hammerman C, Komar K, Abu-Khudair H, Olsen T. Oxygen transport in newborn piglets with pulmonary hypertension. Crit Care Med 16: 773–778, 1988.[ISI][Medline]
  14. Hanasaki K, Arita H. A common binding site for primary prostanoids in vascular smooth muscles: a definitive discrimination of the binding for thromboxane A2/prostaglandin H2 receptor agonist from its antagonist. Biochim Biophys Acta 1013: 28–35, 1989.[Medline]
  15. Haworth SG. Development of the normal and hypertensive pulmonary vasculature. Exp Physiol 80: 843–853, 1995.[Abstract]
  16. Hinton M, Mellow L, Halayko AJ, Gutsol A, Dakshinamurti S. Hypoxia induces hypersensitivity and hyperreactivity to thromboxane receptor agonist in neonatal pulmonary arterial myocytes. Am J Physiol Lung Cell Mol Physiol 290: L375–L384, 2006.[Abstract/Free Full Text]
  17. Hoshi T, Lahiri S. Cell biology. Oxygen sensing: it's a gas! Science 306: 2050–2051, 2004.[Abstract/Free Full Text]
  18. Huang JS, Ramamurthy SK, Lin X, Le Breton GC. Cell signalling through thromboxane A2 receptors. Cell Signal 16: 521–533, 2004.[CrossRef][ISI][Medline]
  19. Jankov RP, Belcastro R, Ovcina E, Lee J, Massaeli H, Lye SJ, Tanswell AK. Thromboxane A2 receptors mediate pulmonary hypertension in 60% oxygen-exposed newborn rats by a cyclooxygenase-independent mechanism. Am J Respir Crit Care Med 166: 208–214, 2002.[Abstract/Free Full Text]
  20. Kinsella BT. Thromboxane A2 signalling in humans: a ‘Tail’ of two receptors. Biochem Soc Trans 29: 641–654, 2001.[CrossRef][ISI][Medline]
  21. Laroche G, Lepine MC, Theriault C, Giguere P, Giguere V, Gallant MA, de Brum-Fernandes A, Parent JL. Oligomerization of the alpha and beta isoforms of the thromboxane A2 receptor: relevance to receptor signaling and endocytosis. Cell Signal 17: 1373–1383, 2005.[CrossRef][ISI][Medline]
  22. Laroche G, Rochdi MD, Laporte SA, Parent JL. Involvement of actin in agonist-induced endocytosis of the G protein-coupled receptor for thromboxane A2: overcoming of actin disruption by arrestin-3 but not arrestin-2. J Biol Chem 280: 23215–23224, 2005.[Abstract/Free Full Text]
  23. Liepinsh E, Baryshev M, Sharipo A, Ingelman-Sundberg M, Otting G, Mkrtchian S. Thioredoxin fold as homodimerization module in the putative chaperone ERp29: NMR structures of the domains and experimental model of the 51 kDa dimer. Structure 9: 457–471, 2001.[Medline]
  24. MacEachern KE, Smith GL, Nolan AM. Characteristics of the in vitro hypoxic pulmonary vasoconstrictor response in isolated equine and bovine pulmonary arterial rings. Vet Anaesth Analg 31: 239–249, 2004.[CrossRef][ISI][Medline]
  25. Madjdpour C, Jewell UR, Kneller S, Ziegler U, Schwendener R, Booy C, Klausli L, Pasch T, Schimmer RC, Beck-Schimmer B. Decreased alveolar oxygen induces lung inflammation. Am J Physiol Lung Cell Mol Physiol 284: L360–L367, 2003.[Abstract/Free Full Text]
  26. Mayeux PR, Morinelli TA, Williams TC, Hazard ES, Mais DE, Oatis JE, Baron DA, Halushka PV. Differential effect of pH on thromboxane A2/prostaglandin H2 receptor agonist and antagonist binding in human platelets. J Biol Chem 266: 13752–13758, 1991.[Abstract/Free Full Text]
  27. McLeod KA, Gerlis LM, Williams GJ. Morphology of the elastic pulmonary arteries in pulmonary hypertension: a quantitative study. Cardiol Young 9: 364–370, 1999.[ISI][Medline]
  28. Mezghrani A, Courageot J, Mani JC, Pugniere M, Bastiani P, Miquelis R. Protein-disulfide isomerase (PDI) in FRTL5 cells. pH-dependent thyroglobulin/PDI interactions determine a novel PDI function in the post-endoplasmic reticulum of thyrocytes. J Biol Chem 275: 1920–1929, 2000.[Abstract/Free Full Text]
  29. Moudgil R, Michelakis ED, Archer SL. Hypoxic pulmonary vasoconstriction. J Appl Physiol 98: 390–403, 2005.[Abstract/Free Full Text]
  30. Noh DY, Shin SH, Rhee SG. Phosphoinositide-specific phospholipase C and mitogenic signaling. Biochim Biophys Acta 1242: 99–113, 1995.[Medline]
  31. Parent JL, Labrecque P, Driss Rochdi M, Benovic JL. Role of the differentially spliced carboxyl terminus in thromboxane A2 receptor trafficking: identification of a distinct motif for tonic internalization. J Biol Chem 276: 7079–7085, 2001.[Abstract/Free Full Text]
  32. Parent JL, Labrecque P, Orsini MJ, Benovic JL. Internalization of the TxA2 receptor alpha and beta isoforms. Role of the differentially spliced COOH terminus in agonist-promoted receptor internalization. J Biol Chem 274: 8941–8948, 1999.[Abstract/Free Full Text]
  33. Peacock AJ, Scott P, Plevin R, Wadsworth R, Welsh D. Hypoxia enhances proliferation and generation of IP3 in pulmonary artery fibroblasts but not in those from the mesenteric circulation. Chest 114, Suppl 1: 24S, 1998.
  34. Reid HM, Kinsella BT. The alpha, but not the beta, isoform of the human thromboxane A2 receptor is a target for nitric oxide-mediated desensitization. Independent modulation of Tp alpha signaling by nitric oxide and prostacyclin. J Biol Chem 278: 51190–51202, 2003.[Abstract/Free Full Text]
  35. Rochdi MD, Parent JL. G{alpha}q-coupled receptor internalization specifically induced by G{alpha}q signaling. Regulation by EBP50. J Biol Chem 278: 17827–17837, 2003.[Abstract/Free Full Text]
  36. Rodman DM, Yamaguchi T, O'Brien RF, McMurtry IF. Hypoxic contraction of isolated rat pulmonary artery. J Pharmacol Exp Ther 248: 952–959, 1989.[Abstract/Free Full Text]
  37. Shimoda LA, Sham JS, Shimoda TH, Sylvester JT. L-type Ca2+ channels, resting [Ca2+]i, and ET-1-induced responses in chronically hypoxic pulmonary myocytes. Am J Physiol Lung Cell Mol Physiol 279: L884–L894, 2000.[Abstract/Free Full Text]
  38. Soukka H, Viinikka L, Kaapa P. Involvement of thromboxane A2 and prostacyclin in the early pulmonary hypertension after porcine meconium aspiration. Pediatr Res 44: 838–842, 1998.[ISI][Medline]
  39. Spurney RF. Regulation of thromboxane receptor (TP) phosphorylation by protein phosphatase 1 (PP1) and PP2A. J Pharmacol Exp Ther 296: 592–599, 2001.[Abstract/Free Full Text]
  40. Steinhorn RH. Persistent pulmonary hypertension of the newborn. Acta Anaesthesiol Scand 111, Suppl: 135–140, 1997.
  41. Suradhat S, Thanawongnuwech R, Poovorawan Y. Upregulation of IL-10 gene expression in porcine peripheral blood mononuclear cells by porcine reproductive and respiratory syndrome virus. J Gen Virol 84: 453–459, 2003.[Abstract/Free Full Text]
  42. Tozzi CA, Christiansen DL, Poiani GJ, Riley DJ. Excess collagen in hypertensive pulmonary arteries decreases vascular distensibility. Am J Respir Crit Care Med 149: 1317–1326, 1994.[Abstract]
  43. Valentin F, Field MC, Tippins JR. The mechanism of oxidative stress stabilization of the thromboxane receptor in COS-7 cells. J Biol Chem 279: 8316–8324, 2004.[Abstract/Free Full Text]
  44. Villanueva ME, Zaher FM, Svinarich DM, Konduri GG. Decreased gene expression of endothelial nitric oxide synthase in newborns with persistent pulmonary hypertension. Pediatr Res 44: 338–343, 1998.[ISI][Medline]
  45. Vuichard D, Ganter MT, Schimmer RC, Suter D, Booy C, Reyes L, Pasch T, Beck-Schimmer B. Hypoxia aggravates lipopolysaccharide-induced lung injury. Clin Exp Immunol 141: 248–260, 2005.[CrossRef][ISI][Medline]
  46. Walsh MC, Stork EK. Persistent pulmonary hypertension of the newborn. Rational therapy based on pathophysiology. Clin Perinatol 28: 609–627, vii, 2001.[CrossRef][ISI][Medline]
  47. Walsh MT, Foley JF, Kinsella BT. The alpha, but not the beta, isoform of the human thromboxane A2 receptor is a target for prostacyclin-mediated desensitization. J Biol Chem 275: 20412–20423, 2000.[Abstract/Free Full Text]
  48. Walsh-Sukys MC, Tyson JE, Wright LL, Bauer CR, Korones SB, Stevenson DK, Verter J, Stoll BJ, Lemons JA, Papile LA, Shankaran S, Donovan EF, Oh W, Ehrenkranz RA, Fanaroff AA. Persistent pulmonary hypertension of the newborn in the era before nitric oxide: practice variation and outcomes. Pediatrics 105: 14–20, 2000.[Abstract/Free Full Text]
  49. Wang Z, Lanner MC, Jin N, Swartz D, Li L, Rhoades RA. Hypoxia inhibits myosin phosphatase in pulmonary arterial smooth muscle cells: role of Rho-kinase. Am J Respir Cell Mol Biol 29: 465–471, 2003.[Abstract/Free Full Text]
  50. Weinberger B, Weiss K, Heck DE, Laskin DL, Laskin JD. Pharmacologic therapy of persistent pulmonary hypertension of the newborn. Pharmacol Ther 89: 67–79, 2001.[CrossRef][ISI][Medline]
  51. Welt K, Weiss J, Martin R, Dettmer D, Hermsdorf T, Asayama K, Meister S, Fitzl G. Ultrastructural, immunohistochemical and biochemical investigations of the rat liver exposed to experimental diabetes und acute hypoxia with and without application of Ginkgo extract. Exp Toxicol Pathol 55: 331–345, 2004.[CrossRef][ISI][Medline]
  52. Wohrley JD, Frid MG, Moiseeva EP, Orton EC, Belknap JK, Stenmark KR. Hypoxia selectively induces proliferation in a specific subpopulation of smooth muscle cells in the bovine neonatal pulmonary arterial media. J Clin Invest 96: 273–281, 1995.[ISI][Medline]
  53. Yan FX, Yamamoto S, Zhou HP, Tai HH, Liao DF. Serine 331 is major site of phosphorylation and desensitization induced by protein kinase C in thromboxane receptor alpha. Acta Pharmacol Sin 23: 952–960, 2002.[ISI][Medline]
  54. Yang X, Sheares KK, Davie N, Upton PD, Taylor GW, Horsley J, Wharton J, Morrell NW. Hypoxic induction of COX-2 regulates proliferation of human pulmonary artery smooth muscle cells. Am J Respir Cell Mol Biol 27: 688–696, 2002.[Abstract/Free Full Text]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
292/3/L654    most recent
00229.2006v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hinton, M.
Right arrow Articles by Dakshinamurti, S.
Right arrow Search for Related Content
PubMed