AJP - Lung Fuel your research with LabChart
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Lung Cell Mol Physiol 293: L182-L190, 2007. First published April 13, 2007; doi:10.1152/ajplung.00319.2006
1040-0605/07 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
293/1/L182    most recent
00319.2006v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (1)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Rehan, V. K.
Right arrow Articles by Torday, J. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Rehan, V. K.
Right arrow Articles by Torday, J. S.

A paradoxical temporal response of the PTHrP/PPAR{gamma} signaling pathway to lipopolysaccharide in an in vitro model of the developing rat lung

Virender K. Rehan,1 Soina K. Dargan-Batra,1 Ying Wang,1 Laura Cerny,1 Reiko Sakurai,1 Jamie Santos,1 Ron Beloosesky,2 Dave Gayle,2 and John S. Torday1,2

Departments of 1Pediatrics and 2Obstetrics and Gynecology, Harbor-University of California at Los Angeles Medical Center, Los Angeles Biomedical Research Institute at Harbor-University of California at Los Angeles, David Geffen School of Medicine at University of California at Los Angeles, Torrance, California

Submitted 18 August 2006 ; accepted in final form 10 April 2007


    ABSTRACT
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Chorioamnionitis alters lung development, resulting in a paradoxical decrease in the incidence of respiratory distress syndrome but an increase in the incidence of bronchopulmonary dysplasia (BPD). The mechanism(s) underlying this disparity in the pulmonary outcomes is not known. We hypothesized that specific alterations in alveolar epithelial-mesenchymal interactions might explain this apparent disparity in the pulmonary outcome following chorioamnionitis. We determined the effects of lipopolysaccharide (LPS) on parathyroid hormone-related protein (PTHrP)-driven epithelial-mesenchymal interactions that are essential for normal lung development and homeostasis. Lung explants from embryonic day 19.5 Sprague-Dawley rat fetuses were treated with LPS with or without a PTHrP pathway agonist, prostaglandin J2 (PGJ2). LPS treatment affected the production of proinflammatory cytokines and the expression of the key markers of the epithelial-mesenchymal paracrine interactions in a time-dependent manner. At 6 h, there was a significant increase in the expression of PTHrP and the other key markers of alveolar homeostasis without any significant effect on {alpha}-smooth muscle actin ({alpha}SMA). In contrast, at 72 h, there was a significant decrease in the expression of PTHrP and the other key markers of alveolar homeostasis accompanied by a significant increase in {alpha}SMA expression. The cytokine and molecular changes at 72 h were completely prevented by the concomitant treatment with PGJ2. We speculate that these data provide a likely mechanism for the acute stimulation of lung differentiation, accompanied paradoxically by BPD following chorioamnionitis, and suggest that by specifically targeting PTHrP signaling, the inflammation-induced molecular injury that is known to result in BPD can be prevented.

bronchopulmonary dysplasia; chorioamnionitis; chronic lung disease; parathyroid hormone-related protein


MOST PRETERM DELIVERIES before 30 wk of gestation are associated with histological chorioamnionitis (1). In fact, recently, using a bacterial molecular probe, Steel et al. (14) demonstrated bacteria deep in the fetal membranes in 90% of 29 preterm deliveries they examined. Although the fetal response to chorioamnionitis varies with the length of gestation, the severity and duration of inflammation, and the organisms involved, there is ample evidence that prenatal lung inflammation in general alters lung development, which is known to result in a decrease in the incidence of respiratory distress syndrome (RDS) (2, 13, 24). However, in contrast to this, RDS is also associated with an increase in the incidence of bronchopulmonary dysplasia (BPD) (3, 23, 24). The mechanism(s) underlying this disparity in the pulmonary outcomes is not known.

Since the spatiotemporal sequence of epithelial-mesenchymal interactions plays a key role in normal lung development and homeostasis, we hypothesized that specific alterations in these cell-cell interactions might explain this apparent disparity in the pulmonary outcome in response to prenatal lung inflammation. Pulmonary epithelial-mesenchymal interactions, driven by epithelially derived parathyroid hormone-related protein (PTHrP), are critical for alveolar development and homeostasis (11, 18). PTHrP secreted by alveolar type II (ATII) cells acts on its receptor on the adjoining alveolar interstitial fibroblasts (AIFs), which are characterized by the expression of PTHrP receptor, peroxisome proliferator-activated-{gamma} (PPAR{gamma}), and adipocyte differentiation-related protein (ADRP). AIFs, in turn, secrete leptin, which acts on its receptor on ATII cells. This paracrine loop enhances surfactant synthesis and is critical in maintaining alveolar homeostasis (16).

Here, using lipopolysaccharide (LPS), an exotoxin released by gram-negative bacteria, as an inflammatory challenge, we examine its effects on the specific pulmonary epithelial-mesenchymal paracrine interactions determined by the expression of PTHrP and PPAR{gamma} in the epithelium and mesenchyme, respectively, in the developing rat lung. Our data suggest that LPS initially induces molecular changes characterized by acceleration followed later by a breakdown in the PTHrP-driven epithelial-mesenchymal paracrine loop, providing a potential integrated mechanism for the acute acceleration of lung differentiation and accounting for reduced RDS accompanied paradoxically by BPD following premature birth associated with chorioamnionitis. Furthermore, by upregulating the key nuclear transcription factor, PPAR{gamma}, these LPS-induced changes are preventable, potentially providing a specific intervention to prevent the BPD that follows chorioamnionitis. A schematic of this information appears in Fig. 1.


Figure 1
View larger version (16K):
[in this window]
[in a new window]

 
Fig. 1. Parathyroid hormone-related protein (PTHrP) secreted by the alveolar type II cell acts on its receptor on the adjoining alveolar interstitial fibroblast, which is characterized by the expression of PTHrP receptor, peroxisome proliferator-activated-{gamma} (PPAR{gamma}), and adipocyte differentiation-related protein (ADRP). Alveolar interstitial fibroblast, in turn, secretes leptin, which acts on its receptor on alveolar type II cell, enhancing surfactant synthesis and alveolar homeostasis.

 

    METHODS
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Lung explant cultures. Lung explants derived from three to five litters of time-mated pregnant rats at embryonic day 19.5 (e19.5) were used for each experiment. Lungs were harvested from fetal rats under sterile conditions. The lung tissue was chopped into ~1-mm cubes and incubated in 0.5 ml of Waymouth's MB-252/1 medium containing penicillin (100 U/ml), streptomycin (100 U/ml), and Fungizone (2.5 mg/ml) in six-well plates while rocking on an oscillating platform (3 cycles/min) in an atmosphere of 5% CO2-air at 37°C (15). The explants were allowed to attach for ~1–2 h before starting the experiments. After attachment, lung explants were treated with LPS (0–50 µg/ml of medium) or LPS plus the PTHrP pathway agonist prostaglandin J2 (PGJ2) for 6, 24, or 72 h. Some experiments were conducted in the presence of the PPAR{gamma} specific antagonist GW-9662. All studies were approved by the Los Angeles Biomedical Research Institute Review Board and were conducted in accordance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals.

Lung fibroblast isolation. Neonatal rat lung fibroblasts were cultured with slight modifications of our previously described method (6, 17). Briefly, the lungs were trimmed to remove major airways and rinsed with calcium- and magnesium-free Hanks' balanced salt solution (HBSS). The HBSS was decanted, and 5 volumes of 0.05% trypsin were added to the lung preparation. The lungs were further dissociated in a 37°C water bath using a Teflon stirring bar to disrupt the tissue mechanically. Once the tissue was dispersed into a unicellular suspension, the cells were pelleted at 500 g for 10 min at room temperature in a 50-ml polystyrene centrifuge tube. The supernatant was decanted, and the pellet was resuspended in MEM containing 20% FBS to yield a mixed cell suspension of ~3 x 108 cells as determined by Coulter particle counter (Beckman-Coulter, Hialeah, FL). The cell suspension was then added to culture flasks (75 cm2) for 20–45 min to allow for differential adherence of the lung fibroblasts. We have observed that this shorter time of adherence (20–45 min) allowed for even greater pure yield of fibroblasts than the 30- to 60-min adherence reported by us previously. These cells are >95% pure fibroblasts based on their morphological appearance when viewed at the light microscopic level and by immunohistochemical staining for vimentin.

Cultured fibroblasts were probed for nuclear translocation of NF-{kappa}B following LPS stimulation with and without another PTHrP pathway agonist, rosiglitazone (RGZ), in the absence or presence of a specific antagonist of the PTHrP/PPAR{gamma} pathway, GW-9662.

ELISA determinations. Commercial ELISA (R&D Systems) kits were used to assay culture media IL-1beta (RLB00) and IL-6 (R6000) levels according to the manufacturer's protocols. Briefly, aliquots of media were pipetted into wells precoated with a specific antibody for rat IL-1beta or IL-6 and allowed to incubate for 2 h. After the wells were rinsed to remove all unbound substances, an enzyme-linked antibody specific for rat IL-1beta or for IL-6 was added to the wells for 2 h. After the wells were rinsed to remove all unbound enzyme-linked antibody, a substrate solution was added to the wells for 30 min to yield a colored product that was quantified by optical density readings at 450 nm. Each assay was run with known standards that were used to determine the quantities of IL-1beta and IL-6 in each sample. For all kits used, the minimum detectable level was <10 pg/ml, with intra- and interassay variations of <10%.

Semiquantitative RT-PCR. RNA was extracted using a standard protocol, and the integrity of the RNA was assessed from the visual appearance of the ethidium bromide-stained ribosomal bands following fractionation on a 1.2% (wt/vol) agarose-formaldehyde gel and quantitated by absorbance at 260 nm. RT-PCR primers used included: rat PPAR{gamma}, 5' TGATATCGACCAGCTGAACC and 3' TGGCGAACAGCTGAGAGGAC; rat ADRP, 5' GAACAAAGGTCCTCATTATGG and 3' ACAGTGATGAAGCCTGCTC; rat surfactant protein-B (SP-B), 5' TACACAGTACTTCTACTAGATG and 3' ATAGGCTGTTCACTGGTGTTCC; rat {alpha}-smooth muscle actin ({alpha}SMA), 5' CGCAAATATTCTGTCTGGATCG and 3' TCACAGTTGTGTGCTAGAGACA; and rat 18S, 5' TTAAGCCATGCATGTCTAAGTAC and 3' TGTTATTTTTCGTCACTACCTCC. RT-PCR was performed in a RoboCycler (Stratagene, La Jolla, CA), and the PCR products were visualized on 2% agarose gels by ethidium bromide staining and photographed under UV light. Band densities were quantified using the Eagle Eye II system (Stratagene). The expression of different mRNA was normalized to 18S mRNA levels.

Measurement of triglyceride uptake. The triglyceride uptake assay was performed as described previously (16). Briefly, cultured lung explants were exposed to [3H]triolein (5 µCi/ml) at 37°C in 5% CO2-balance air for 4 h. At the termination of the incubation, the medium was decanted, the explants were rinsed twice with 1 ml of ice-cold PBS, and the tissue was removed from the culture plate after a 5- to 10-min incubation with 2 ml of a 0.05% trypsin solution. An aliquot of the tissue suspension was taken for protein assay (2), and the remaining tissue suspension was extracted for neutral lipid content.

Western blot analysis. Protein extraction and Western blot analyses for PPAR{gamma}, ADRP, SP-B, {alpha}SMA, NF-{kappa}B, and GAPDH were performed using standard methods. Briefly, cells were homogenized in 10 mM Tris (hydroxymethyl) aminomethane (Tris, pH 7.5), 0.25 M sucrose, 1 mM EDTA, 5 mM benzamidine, 2 mM phenylmethylsulfonyl fluoride (PMSF), and 10 µg/ml each of pepstatin A, aprotinin, and leupeptin and centrifuged at 14,000 rpm for 10 min (4°C). Equal amounts of the protein from the supernatant were dissolved in electrophoresis sample buffer and subjected to sodium dodecyl sulfate-polyacrylamide (4–12% gradient) gel electrophoresis followed by electrophoretic transfer to a nitrocellulose membrane. The membrane was blocked with 5% milk in 1x Tris-buffered saline containing 0.1% Tween 20 (TBST) for 1 h and then incubated with specific primary antibodies (PPAR{gamma}, 1:2,000, Alexis Biochemicals, San Diego, CA; SP-B, 1:2,000, Chemicon, Temecula, CA; {alpha}SMA, 1:50,000, Sigma, St. Louis, MO; ADRP, 1:3,000, a kind gift from Dr. Constantine Londos, National Institute of Diabetes and Digestive and Kidney Diseases; GAPDH, 1:5,000, Chemicon; and NF-{kappa}B, 1:2,000, Stressgen) overnight at 4°C. Subsequently, the membrane was washed with TBST and incubated with a 1:3,000 dilution of anti-rabbit horseradish peroxidase linked whole antibody IgG (Amersham, Arlington Heights, IL) for 1 h at room temperature, washed again, and developed with a chemiluminescent substrate (ECL, Amersham) following the manufacturer's protocol. The density of the protein bands was quantified using a scanning densitometer (Eagle Eye, Stratagene), and the results were normalized for GAPDH expression.

Preparation of nuclear extract. Confluent cells were washed twice with ice-cold PBS. Cell layers were scraped in low-salt buffer: 10 mM HEPES, pH 7.9, 0.1% Nonidet P-40, 1.5 mM MgCl2, 10 mM KCl, 1 mM EGTA, 1 mM EDTA, 0.5 mM DTT, 0.5 mM PMSF, 10 µg/ml pepstatin, 10 µg/ml aprotinin, and 10 µg/ml leupeptin. The cellular suspension was incubated on ice for 1 h with gentle shaking every 15 min and sedimented by centrifugation (10,000 g) for 10 min at 4°C. The resultant pellet was resuspended in a high-salt buffer containing 20 mM HEPES, pH 7.9, 25% glycerol, 1 mM MgCl2, 420 mM NaCl, 0.2 mM EDTA, 0.5 mM DTT, 0.5 mM PMSF, 10 µg/ml pepstatin, 10 µg/ml aprotinin, and 10 µg/ml leupeptin and incubated for 3 h with gentle shaking every 15 min. The nuclear suspension was centrifuged at 10,000 g for 10 min at 4°C. The supernatants were collected and stored in 50-µl aliquots at –80°C until processing.

NF-{kappa}B immunofluorescence staining. In brief, cells were cultured on Lab-Tek four-chamber slides under control and experimental conditions (LPS treatment). At the end of the experimental period, the slides were washed twice with ice-cold PBS and then fixed in freshly prepared 4% paraformaldehyde. Fixed slides were washed in PBS, blocked with 3% normal goat serum (Jackson Immunoresearch) in PBS for 30 min at room temperature to block nonspecific binding, and then incubated with primary NF-{kappa}B antibody (1:200) overnight at 4°C. Secondary goat anti-rabbit conjugated Texas red IgG was used at a 1:200 dilution for 30 min. The slides were washed three times with PBS and then mounted and cover-slipped with Vectashield mounting medium with 4,6-diamidino-2-phenylindole (DAPI; Vector Laboratories) for visualization under fluorescence microscope.

Statistical analysis. ANOVA for multiple comparisons with Newman-Keuls post hoc test and Student's t-test, as indicated, were used to analyze the experimental data. P < 0.05 was considered to indicate statistically significant differences in the expression of markers of interest among the control, LPS, and LPS + PPAR{gamma} agonist/antagonist treatment groups.


    RESULTS
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
We initially examined the dose-response for LPS-stimulated IL-6 and IL-1beta release by e19.5 fetal rat lung explants (Fig. 2). Fetal rat lung explants were treated with LPS in a dose range between 0–50 µg/ml for 24 h, following which IL-6 (Fig. 2A) and IL-1beta (Fig. 2B) contents of the media were analyzed by ELISA. LPS increased the IL-6 content of the media by 13-fold at 0.1 µg/ml and showed a further, rather modest (-fold) increase between 0.1–50 µg/ml; IL-1beta content of the media increased by 15-fold at 0.1 µg/ml and by additional one-half-fold between 0.1–50 µg/ml. Subsequent experiments on lung explants were performed using a 50 µg/ml LPS dose. LPS treatment of e19.5 fetal lung explants for 6 h (Fig. 3) stimulated IL-6 production (Fig. 3A) by ~25-fold and by an additional one-half-fold at 72 h, an effect that was completely blocked by simultaneous treatment with PGJ2 (25 µg/ml). Similarly, in vitro LPS treatment (50 µg/ml) of e19.5 fetal lung explants for 6 h stimulated IL-1beta production (Fig. 3B) by ~20-fold, an effect that increased an additional 3.5-fold by 72 h and was completely blocked by simultaneous treatment with PGJ2 (25 µg/ml). LPS (50 µg/ml) significantly stimulated the expression of PTHrP, PPAR{gamma}, ADRP, and SP-B mRNA (P < 0.05 vs. untreated control; Fig. 4) with no significant effect on {alpha}SMA mRNA expression; in contrast, at 72 h, there was a significant decrease in the expression of PTHrP, PPAR{gamma}, ADRP, and SP-B mRNA accompanied by a significant increase in {alpha}SMA mRNA expression (P < 0.05 vs. untreated control; Fig. 4). However, at 72 h, concomitant treatment with PGJ2 completely blocked the LPS-induced inhibition of PPAR{gamma}, ADRP, and SP-B mRNA expression with an accompanying increase in {alpha}SMA mRNA expression (P < 0.05, vs. control; P < 0.05 vs. LPS-treated group; Fig. 5). Similar to the mRNA data, LPS-induced inhibition of PPAR{gamma}, ADRP, and SP-B protein expression (Fig. 6) and stimulation of {alpha}SMA protein expression at 72 h were blocked by concomitant treatment with PGJ2 (P < 0.05 vs. untreated control and P < 0.05 vs. LPS-treated group). Consistent with these data, triglyceride uptake, a downstream target of PPAR{gamma} and an important functional marker of alveolar homeostasis, was significantly decreased at 72 h following LPS stimulation of e19.5 explants, and this decrease was completely prevented with PGJ2 treatment (P < 0.05 vs. untreated control and P < 0.05 vs. LPS-treated group; Fig. 7).


Figure 2
View larger version (8K):
[in this window]
[in a new window]

 
Fig. 2. A and B: dose-response for IL-6 (A) and IL-1beta (B) release by embryonic day 19.5 (e19.5) fetal rat lung explants on treatment with LPS (0–50 µg/ml of media for 24 h). The LPS treatment increased the IL-6 content of the media by ~13-fold at 0.1 µg/ml, which further increased by ~20% between 0.1–50 µg/ml; IL-1beta content of the media increased by 15-fold at 0.1 µg/ml and by another ~-fold between 0.1–50 µg/ml (*P < 0.05 vs. control by ANOVA, n = 3).

 

Figure 3
View larger version (7K):
[in this window]
[in a new window]

 
Fig. 3. A and B: time course for for IL-6 (A) and IL-1beta (B) release by e19.5 fetal rat lung explants on treatment with LPS (50 µg/ml of media) and the effect of concomitant treatment with prostaglandin J2 (PGJ2; 25 µg/ml) are shown. At 6 h, IL-6 content of the media increased by ~25-fold, an effect that increased another ~50% by 72 h. At 6 h, IL-1beta content of the media increased by 20-fold, an effect that increased another 3.5-fold by 72 h. Concomitant treatment with PGJ2 completely blocked the effect of LPS at all time points (*P < 0.0001 vs. control by ANOVA, n = 3).

 

Figure 4
View larger version (20K):
[in this window]
[in a new window]

 
Fig. 4. Shown is the time course for the effect of LPS on mRNA expression of the key PTHrP-driven alveolar epithelial-mesenchymal genes on treatment of e19.5 fetal rat lung explants by LPS (50 µg/ml). Controls are shown in white bars, and LPS treatment in black bars. LPS significantly stimulated the expression of PTHrP, PPAR{gamma}, ADRP, and surfactant protein-B (SP-B) mRNA (*P < 0.05 vs. untreated control) with no significant effect on {alpha}-smooth muscle actin ({alpha}SMA) mRNA expression at 6 h; however, in contrast, at 72 h, there was a significant decrease in the expression of PTHrP, PPAR{gamma}, ADRP, and SP-B mRNA accompanied by a significant increase in {alpha}SMA mRNA expression (*P < 0.05 vs. untreated control by ANOVA, n = 3). Representative RT-PCR blots and densitometric histograms for PTHrP, PPAR{gamma}, ADRP, SP-B, {alpha}SMA, and 18S mRNA expression are shown.

 

Figure 5
View larger version (28K):
[in this window]
[in a new window]

 
Fig. 5. Shown is the effect of concomitant treatment with a PPAR{gamma} agonist, PGJ2, on mRNA expression of the key PTHrP-driven alveolar epithelial-mesenchymal genes on treatment of e19.5 fetal rat lung explants by LPS (50 µg/ml). Concomitant treatment with PGJ2 (25 µM) blocked the LPS-induced inhibition of PPAR{gamma}, ADRP, and SP-B mRNA expression, along with the accompanying increase in {alpha}SMA mRNA expression at 72 h (*P < 0.05 vs. untreated control and ^P < 0.05 vs. LPS-treated group by ANOVA, n = 3). Representative RT-PCR blots and densitometric histograms for PPAR{gamma}, ADRP, SP-B, {alpha}SMA, and 18S mRNA expression are shown.

 

Figure 6
View larger version (22K):
[in this window]
[in a new window]

 
Fig. 6. Shown is the effect of concomitant treatment with a PPAR{gamma} agonist, PGJ2, on protein expression of the key PTHrP-driven alveolar epithelial-mesenchymal genes on treatment of e19.5 fetal rat lung explants by LPS (50 µg/ml). Concomitant treatment with PGJ2 (25 µM) completely blocked the LPS-induced inhibition of PPAR{gamma}, ADRP, and SP-B expression along with the accompanying increase in {alpha}SMA protein expression at 72 h (*P < 0.05 vs. untreated control and ^P < 0.05 vs. LPS-treated group by ANOVA, n = 3). Representative Western blots and densitometric histograms for PPAR{gamma}, ADRP, SP-B, {alpha}SMA, and GAPDH expression are shown.

 

Figure 7
View larger version (9K):
[in this window]
[in a new window]

 
Fig. 7. Shown is a significant decrease in triglyceride uptake at 72 h following LPS treatment of e19.5 fetal rat lung explants, which was completely prevented with concomitant PGJ2 (25 µM) treatment (*P < 0.05 vs. untreated control and ^P < 0.05 vs. LPS-treated group by ANOVA, n = 3). Cpm, Counts per minute.

 
The AIFs play a major role in lung homeostasis and injury/repair, and since, in other organs, LPS has been shown to affect PPAR{gamma} expression via NF-{kappa}B activation (13a), we next examined the effect of LPS on NF-{kappa}B activation in cultured e19.5 fetal rat lung fibroblasts. Consistent with a specific effect of LPS on the expression of the phenotypic fibroblast markers, PPAR{gamma} and ADRP, nuclear expression of the inflammatory mediator NF-{kappa}B increased ~40-fold (Fig. 8) following 2 h of LPS stimulation, an effect that was completely blocked by the PPAR{gamma} agonist RGZ. Furthermore, the PPAR{gamma} antagonist GW-9662 blocked the RGZ-mediated inhibition of the LPS-induced increase in nuclear NF-{kappa}B expression (P < 0.05 vs. untreated control; P < 0.05 vs. LPS-treated group; and P < 0.05 vs. LPS + RGZ group by ANOVA; n = 3). The increased nuclear localization of NF-{kappa}B in e19.5 fetal rat lung fibroblasts on LPS (1 µg/ml) stimulation was also corroborated by immunohistochemistry (Fig. 9), an effect that increased progressively from 2 to 6 to 24 h. This effect of LPS treatment of e19.5 fetal rat lung fibroblasts on NF-{kappa}B nuclear localization was prevented by simultaneous treatment with RGZ (Fig. 10), and the PPAR{gamma} ligand antagonist, GW-9662, blocked the effect of RZG. Since the LPS-induced nuclear localization of NF-{kappa}B was completely blocked by a specific PPAR{gamma} antagonist, GW-9662, it underpins the specificity of PPAR{gamma} expression in mediating this response and the downstream effects of NF-{kappa}B activation.


Figure 8
View larger version (15K):
[in this window]
[in a new window]

 
Fig. 8. Shown is the effect of LPS on NF-{kappa}B activation in cultured e19.5 fetal rat lung fibroblasts. LPS (1 µg/ml) treatment (2 h) resulted in a significant increase in nuclear expression of NF-{kappa}B, an effect that was completely blocked by the PPAR{gamma} agonist, rosiglitazone (RGZ). Furthermore, the PPAR{gamma} antagonist GW-9662 blocked the RGZ-mediated inhibition of the LPS-induced increase in nuclear NF-{kappa}B expression (*P < 0.05 vs. untreated control; **P < 0.05 vs. LPS-treated group; and ^P < 0.05 vs. LPS + RGZ group by ANOVA, n = 3). Representative Western blots and the corresponding densitometric histograms are shown.

 

Figure 9
View larger version (38K):
[in this window]
[in a new window]

 
Fig. 9. Shown is the progressive increase in NF-{kappa}B nuclear localization in e19.5 fetal rat lung fibroblasts with LPS (1 µg/ml) stimulation. Representative immunofluorescence staining for NF-{kappa}B in control and LPS-treated fibroblasts is shown. Arrows point to NF-{kappa}B localization. With LPS treatment, there is a progressive translocation of NF-{kappa}B from the cytoplasm (red staining) to the nucleus (pink staining) from 2 to 6 to 24 h (magnification x20).

 

Figure 10
View larger version (34K):
[in this window]
[in a new window]

 
Fig. 10. Shown is the effect of PPAR{gamma} modulation on LPS-induced nuclear translocation of NF-{kappa}B in cultured e19.5 fetal rat lung fibroblasts. Arrows point to NF-{kappa}B localization. LPS (1 µg/ml)-induced increase in NF-{kappa}B nuclear translocation at 24 h was blocked by the PPAR{gamma} agonist, RGZ. Furthermore, the PPAR{gamma} antagonist, GW-9662, blocked the RGZ-mediated inhibition of the LPS-induced increase in nuclear NF-{kappa}B expression (magnification x40).

 

    DISCUSSION
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Exposure of e19.5 lung explants to LPS increased the production of the proinflammatory cytokines IL-6 and IL-1beta, effects which were completely prevented by concomitant treatment with a PPAR{gamma} agonist, PGJ2. LPS treatment affected the expression of the key markers of the PTHrP-driven epithelial-mesenchymal paracrine loop in a time-dependent manner. At 6 h, there were significant increases in the expression of PTHrP, PPAR{gamma}, ADRP, and SP-B, whereas there was no significant effect on the expression of {alpha}SMA. In contrast, at 72 h, there was a significant decrease in the expression of PTHrP, PPAR{gamma}, ADRP, and SP-B accompanied by a significant increase in the expression of {alpha}SMA. The molecular changes at 72 h were completely prevented by the concomitant treatment with the PPAR{gamma} agonist PGJ2. These data possibly provide an integrated molecular mechanism for the acute stimulation of lung differentiation, accounting for the decrease in the incidence of RDS but, in the long run, resulting paradoxically in BPD. Furthermore, these data strongly suggest that treatment with specific agonists of epithelial-mesenchymal interactions, specifically targeting molecular reinforcement of PPAR{gamma}, can prevent inflammation-induced lung molecular injury that is known to be associated with BPD (21).

Chorioamnionitis is associated with adverse fetal consequences such as lung and brain injuries (23, 25). Although respiratory consequences of chorioamnionitis may depend on the host susceptibility, e.g., degree of prematurity, organisms causing chorioamnionitis, and the duration and intensity of inflammation, in general, there is early accelerated clinical lung maturation that is often associated with a later onset of BPD (2, 3, 13, 23, 24). As alluded to above, the molecular/cellular mechanism(s) underlying this disparity between the short- and long-term pulmonary outcomes is not known, the understanding of which is fundamental in designing any effective and safe preventive and therapeutic strategy. In this study, we have demonstrated how LPS can affect the PTHrP-driven homeostatic epithelial-mesenchymal paracrine signaling that is essential for normal alveolar development and for PPAR{gamma} expression, which is a key downstream molecule in this process. We have clearly demonstrated that modulation of PPAR{gamma} with PPAR{gamma} agonists can completely block the LPS-induced proinflammatory cytokine and profibrotic molecular responses. Although the effects of various known PPAR{gamma} agonists on PPAR{gamma} expression and its downstream targets may be ligand- and tissue-specific, in this study, the LPS-induced molecular changes were blocked by both PGJ2 and RGZ, further suggesting the centrality of PPAR{gamma} in LPS-induced lung injury. This is also supported by the fact that pretreatment with the specific PPAR{gamma} antagonist GW-9662 completely blocked either the PGJ2- or the RGZ-mediated inhibition of the LPS-induced molecular changes.

PTHrP is a stretch-sensitive protein that is expressed by the developing lung epithelium and is upregulated during late fetal lung development (12). It signals to the neighboring alveolar mesenchymal cells through its seven-transmembrane spanning, G-protein-dependent receptor, stimulating their lipogenic phenotype. The critical downstream target for PTHrP/PTHrP receptor signaling is PPAR{gamma}, which in turn controls other lipogenic regulatory genes such as ADRP and leptin (17). Therefore, stimulation of PPAR{gamma} induces the lipogenic phenotype, which is necessary for maintaining alveolar homeostasis through its autocrine effect on interstitial fibroblasts and its paracrine effect on ATII cells. Specifically, the interstitial lipofibroblast phenotype is of functional importance as it provides cytoprotection against oxygen free radicals, traffics neutral lipid substrate to ATII cells for surfactant phospholipid synthesis, and causes ATII cell proliferation (16, 20, 21). Although myofibroblasts also seem to be important for normal lung development, these cells are also the hallmark of chronic lung diseases in both the neonate and adult. In the developing lung, myofibroblasts are fewer in number and are predominantly located at the periphery of the alveolar septa, where they very likely participate in the formation of new septa (7, 22). However, in chronic lung diseases, myofibroblasts not only increase in number but also are located in the center of the alveolar septum in great abundance (22). In line with these observations, we (6, 19) have previously demonstrated that on exposure to insults such as volutrauma or hyperoxia, fetal rat lung lipofibroblasts transdifferentiate to myofibroblasts. Our present data also implicate lipo-to-myofibroblast transdifferentiation as the potential underlying mechanism for the inflammation-induced lung damage in the developing fetus.

We have delineated the effects of LPS only on the PTHrP-driven epithelial-mesenchymal paracrine signaling under in vitro conditions. The pulmonary effects of chorioamnionitis under in vivo conditions are undoubtedly more complicated due to the confounding effects of infection on other alveolar cell types, e.g., endothelium, resident macrophages, etc., and its effects on placenta, amniotic membranes, and uterus. Therefore, it is possible that our in vitro findings using a fetal rat explant model may not exactly replicate the pulmonary response to chorioamnionitis in vivo. However, the early (6 h) and late (72 h) effects of LPS on PTHrP-driven epithelial-mesenchymal signaling do provide a plausible explanation for both the decrease in RDS and the increase in BPD following chorioamnionitis. Moreover, consistent with data from others, our present studies also support the view that infection (LPS) can affect lung development by its effects directly on the fetal lung rather than through other maternal or fetal influences (4, 9, 10). In a mouse model of LPS-induced chorioamnionitis, Prince et al. (10) recently observed an NF-{kappa}B-mediated increase in ATII cell number and maturation. Inhibition of NF-{kappa}B activation following LPS exposure completely blocked the LPS-induced increase in type II cells. Since we have previously shown that activation of PTHrP/PTHrP receptor signaling and maintenance of the alveolar interstitial lipofibroblast phenotype promotes ATII cell proliferation and differentiation, it is very likely that following chorioamnionitis, activation of homeostatic PTHrP/PTHrP receptor signaling is the underlying mechanism for the increase in ATII cell number and increased surfactant synthesis in the short term. Furthermore, with chronic inflammation, a breakdown of this mechanism in the long-run results in a shift in the mesenchyme from a lipogenic phenotype to a myogenic phenotype. The mesenchymal myogenic phenotype is not only not supportive of ATII cell proliferation and differentiation, but also supports failed alveolarization, the hallmark of BPD (21). On LPS treatment of the isolated fetal lung explants and fibroblasts, we see an initial pro-homeostatic and later profibrotic pattern of lung injury. These responses obviously occur in the absence of any recruited inflammatory cells. Therefore, recruitment of inflammatory cells, although a likely important modifier, may not be absolutely essential for accelerated lung maturation following inflammation, as has been previously suggested in a preterm sheep model of induced chorioamnionitis (5). However, species and methodological differences between our and other studies may explain the differences in these conclusions (5).

It is important to note that although we studied the Escherichia coli exotoxin LPS as a model of inflammation and its effects on lung development, in clinical settings, Ureaplasma urealyticum is the most common cause of chorioamnionitis (26), and the mechanism of pulmonary changes secondary to its infection may be different from that observed in response to LPS exposure. However, similar to the pulmonary response following LPS treatment of lung explants observed by us, U. urealyticum colonization at birth in extremely preterm infants is associated with a lower incidence of RDS but a higher incidence of BPD (2).

In summary, the data presented provide an integrated mechanism for the acute stimulation of lung differentiation accompanied paradoxically by BPD following intrauterine inflammation. We suggest that specifically targeting epithelial-mesenchymal interactions via specific agonists of PPAR{gamma} signaling can prevent inflammation-induced molecular lung injury that is known to result in BPD.


    GRANTS
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
This study was supported by grants from National Heart, Lung, and Blood Institute (HL-55268 and HL-075405), American Heart Association (10868-02), Philip Morris USA and Philip Morris International (11108-02), and the Tobacco-Related Disease Research Program (14RT-0073 and 15IT-0250).


    FOOTNOTES
 

Address for reprint requests and other correspondence: V. K. Rehan, Dept. of Pediatrics, Los Angeles Biomedical Research Institute at Harbor-UCLA Medical Center, David Geffen School of Medicine at UCLA, 1124 West Carson St., Torrance, CA 90502 (e-mail: vrehan{at}labiomed.org)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 

  1. Goldenberg RL, Hauth JC, Andrews WW. Intrauterine infection and preterm delivery. N Engl J Med 342: 1500–1507, 2000.[Free Full Text]
  2. Hannaford K, Todd DA, Jeffrey H, John E, Byth K, Gilbert GL. Role of Ureaplasma urealyticum in lung disease of prematurity. Arch Dis Child Fetal Neonatal Ed 81: F162–F167, 1999.[Abstract/Free Full Text]
  3. Jobe AH. Antenatal associations with lung maturation and infection. J Perinatol 25, Suppl 2: S31–S35, 2005.[CrossRef][Medline]
  4. Jobe AH, Newnhan JP, Willet KE, Moss TJ, Ervin MG, Padbury JF, Sly PD, Ikegami M. Endotoxin-induced lung maturation in preterm lambs is not mediated by cortisol. Am J Respir Crit Care Med 162: 1656–1661, 2000.[Abstract/Free Full Text]
  5. Kallapur SG, Moss TJ, Ikegami M, Jasman RL, Newnham JP, Jobe AH. Recruited inflammatory cells mediate endotoxin-induced lung maturation in preterm fetal lambs. Am J Respir Crit Care Med 172: 1315–1321, 2005.[Abstract/Free Full Text]
  6. László BG, Torday JS, Lee WNP, Rehan VK. Oxygen-induced metabolic changes and transdifferentiation in immature fetal rat lung lipofibroblasts. Mol Genet Metab 77: 230–236, 2002.[CrossRef][ISI][Medline]
  7. Leslie KO, Mitchell JL, Low RB. Alpha smooth muscle actin expression in developing and adult human lung. Differentiation 44: 143–149, 1990.[CrossRef][ISI][Medline]
  8. Moss TJ, Nitsos I, Kramer BW, Ikegami M, Newnham JP, Jobe AH. Intra-amniotic endotoxin induces lung maturation by direct effects on the developing respiratory tract in preterm sheep. Am J Obstet Gynecol 187: 1059–1065, 2002.[CrossRef][ISI][Medline]
  9. Prince LS, Okoh VO, Moninger TO, Matalon S. Lipopolysaccharide increases alveolar type II cell number in fetal mouse lungs through Toll-like receptor 4 and NF-{kappa}B. Am J Physiol Lung Cell Mol Physiol 287: L999–L1006, 2004.[Abstract/Free Full Text]
  10. Rubin LP, Kovacs CS, De Paepe ME, Tsai SW, Torday JS, Kronenberg HM. Arrested pulmonary alveolar cytodifferentiation and defective surfactant synthesis in mice missing the gene for parathyroid hormone-related protein. Dev Dyn 230: 278–289, 2004.[CrossRef][ISI][Medline]
  11. Rubin LP, Torday JS. Parathyroid hormone-related protein (PTHrP) biology in fetal lung development. In: Endocrinology of the Lung: Development and Surfactant Synthesis, edited by Mendelson CR. Totowa, NJ: Humana, 2000, p. 269–297.
  12. Shimoya K, Taniguchi T, Matsuzaki N, Moriyama A, Murata Y, Kitajima H, Fujimura M, Nakayama M. Chorioamnionitis decreased incidence of respiratory distress syndrome by elevating fetal interleukin-6 serum concentration. Hum Reprod 15: 2234–2240, 2000.[Abstract/Free Full Text]
  13. Simonin MA, Bordji K, Boyault S, Bianchi A, Gouze E, Becuwe P, Dauca M, Netter P, Terlain B. PPAR-{gamma} ligands modulate effects of LPS in stimulated rat synovial fibroblasts. Am J Physiol Cell Physiol 282: C125–C133, 2002.[Abstract/Free Full Text]
  14. Steel JH, Malatos S, Kennea N, Edwards AD, Miles L, Duggan P, Reynolds PR, Feldman RG, Sullivan MH. Bacteria and inflammatory cells in fetal membranes do not always cause preterm labor. Pediatr Res 57: 404–411, 2005.[CrossRef][ISI][Medline]
  15. Torday JS. Androgens delay human fetal lung maturation in vitro. Endocrinology 126: 3240–3244, 1990.[Abstract]
  16. Torday J, Hua J, Slavin R. Metabolism and fate of neutral lipids of fetal lung fibroblast origin. Biochim Biophys Acta 1254: 198–206, 1995.[Medline]
  17. Torday JS, Rehan VK. Stretch-stimulated surfactant synthesis is coordinated by the paracrine actions of PTHrP and leptin. Am J Physiol Lung Cell Mol Physiol 283: L130–L135, 2002.[Abstract/Free Full Text]
  18. Torday JS, Rehan VK. Deconvoluting lung evolution using functional/comparative genomics. Am J Respir Cell Mol Biol 31: 8–12, 2004.[Abstract/Free Full Text]
  19. Torday JS, Rehan VK. Mechanotransduction determines the structure and function of lung and bone: a theoretical model for the pathophysiology of chronic disease. Cell Biochem Biophys 37: 235–246, 2003.[ISI][Medline]
  20. Torday JS, Torday DP, Gutnick J, Quin J, Rehan V. The biologic role of fetal lung fibroblast triglycerides as antioxidants. Pediatr Res 49: 843–849, 2001.[ISI][Medline]
  21. Torday JS, Torres E, Rehan VK. The role of fibroblast transdifferentiation in lung epithelial cell proliferation, differentiation, and repair in vitro. Pediatr Pathol Mol Med 22: 189–207, 2003.[CrossRef][ISI][Medline]
  22. Toti P, Buonocore G, Tanganelli P, Catella AM, Palmeri M, Vatti R, Seemayer T. Bronchopulmonary dysplasia of the premature baby: an immunohistochemical study. Pediatr Pulmonol 24: 22–28, 1997.[ISI][Medline]
  23. Viscardi RM, Muhumuza CK, Rodriguez A, Fairchild KD, Sun CC, Gross GW, Campbell AB, Wilson PD, Hester L, Hasday JD. Inflammatory markers in intrauterine and fetal blood and cerebrospinal fluid compartments are associated with adverse pulmonary and neurologic outcomes in preterm infants. Pediatr Res 55: 1009–1017, 2004.[CrossRef][ISI][Medline]
  24. Watterberg KL, Demers LM, Scott SM, Murphy S. Chorioamnionitis and early lung inflammation in infants in whom bronchopulmonary dysplasia develops. Pediatrics 97: 210–215, 1996.[Abstract/Free Full Text]
  25. Wharton KN, Pinar H, Stonestreet BS, Tucker R, McLean KR, Wallach M, Vohr BR. Severe umbilical cord inflammation–a predictor of periventricular leukomalacia in very low birth weight infants. Early Hum Dev 77: 77–87, 2004.[CrossRef][ISI][Medline]
  26. Yoon B, Romero B, Park J, Chang J, Kim Y, Kim J, Kim K. Microbial invasion of the amniotic cavity with Ureaplasma urealyticum is associated with a robust host response in fetal, amniotic, and maternal compartments. Am J Obstet Gynecol 179: 1254–1260, 1998.[CrossRef][ISI][Medline]



This article has been cited by other articles:


Home page
NeoReviewsHome page
B. A. Yoder and K. H. Albertine
Inflammation and Lung Disease in the Neonatal Period
NeoReviews, October 1, 2008; 9(10): e447 - e457.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
293/1/L182    most recent
00319.2006v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (1)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Rehan, V. K.
Right arrow Articles by Torday, J. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Rehan, V. K.
Right arrow Articles by Torday, J. S.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2007 by the American Physiological Society.